Incidental Mutation 'R4080:Aspm'
ID500482
Institutional Source Beutler Lab
Gene Symbol Aspm
Ensembl Gene ENSMUSG00000033952
Gene Nameabnormal spindle microtubule assembly
SynonymsAspm, Sha1, MCPH5, D330028K02Rik, Calmbp1
MMRRC Submission 040856-MU
Accession Numbers

Genbank: NM_009791; MGI: 1334448

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4080 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location139454772-139494091 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 139470755 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 1024 (Q1024K)
Ref Sequence ENSEMBL: ENSMUSP00000142880 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053364] [ENSMUST00000200083]
Predicted Effect probably damaging
Transcript: ENSMUST00000053364
AA Change: Q1024K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000059159
Gene: ENSMUSG00000033952
AA Change: Q1024K

DomainStartEndE-ValueType
Pfam:ASH 29 126 8.9e-35 PFAM
low complexity region 855 861 N/A INTRINSIC
CH 890 1022 2.04e0 SMART
CH 1080 1224 5.56e-9 SMART
IQ 1233 1255 7.57e0 SMART
IQ 1259 1281 1.12e1 SMART
IQ 1282 1304 3.73e-1 SMART
IQ 1314 1336 2.41e-4 SMART
IQ 1360 1382 2.12e1 SMART
IQ 1387 1408 7.61e1 SMART
IQ 1409 1431 6.97e0 SMART
IQ 1432 1452 1.44e1 SMART
IQ 1453 1475 1.15e-1 SMART
IQ 1476 1495 1.66e2 SMART
IQ 1503 1525 1.65e-2 SMART
IQ 1526 1548 1.32e1 SMART
IQ 1549 1571 1.48e1 SMART
IQ 1572 1594 2.5e1 SMART
IQ 1599 1621 2.58e-4 SMART
IQ 1622 1644 6.7e-3 SMART
IQ 1645 1667 4.25e1 SMART
IQ 1668 1694 1.03e2 SMART
IQ 1695 1717 2.33e-2 SMART
IQ 1718 1740 7.79e0 SMART
IQ 1741 1763 1.57e2 SMART
IQ 1768 1790 2.68e-2 SMART
IQ 1791 1813 5.83e-3 SMART
IQ 1814 1836 5.93e1 SMART
IQ 1841 1863 1.92e-3 SMART
IQ 1864 1886 3.79e-2 SMART
IQ 1914 1936 4.11e0 SMART
IQ 1937 1959 1.87e-1 SMART
IQ 1960 1982 6.27e1 SMART
IQ 1987 2009 8.25e-3 SMART
IQ 2010 2032 5.73e0 SMART
IQ 2060 2082 1.39e0 SMART
IQ 2083 2105 4.62e1 SMART
IQ 2133 2155 5.58e0 SMART
IQ 2156 2178 7.07e-2 SMART
IQ 2206 2228 1.18e-3 SMART
IQ 2229 2251 4.59e0 SMART
IQ 2278 2300 1.85e-5 SMART
IQ 2301 2323 8.13e-2 SMART
IQ 2342 2364 9.62e-4 SMART
IQ 2365 2387 4.12e-3 SMART
IQ 2415 2437 7.58e-2 SMART
IQ 2438 2460 2.6e0 SMART
IQ 2490 2512 1.68e-3 SMART
IQ 2513 2535 8.51e1 SMART
IQ 2560 2582 2.14e-1 SMART
IQ 2601 2623 8.46e0 SMART
IQ 2647 2669 1.15e1 SMART
IQ 2673 2695 1.95e-4 SMART
IQ 2696 2718 4.13e1 SMART
IQ 2723 2745 1.02e-2 SMART
IQ 2761 2783 3.14e2 SMART
IQ 2784 2806 1e1 SMART
IQ 2825 2847 2.43e0 SMART
IQ 2848 2870 4.6e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199998
Predicted Effect probably damaging
Transcript: ENSMUST00000200083
AA Change: Q1024K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000142880
Gene: ENSMUSG00000033952
AA Change: Q1024K

DomainStartEndE-ValueType
low complexity region 855 861 N/A INTRINSIC
CH 890 1022 2.04e0 SMART
CH 1080 1224 5.56e-9 SMART
IQ 1233 1255 7.57e0 SMART
IQ 1259 1281 1.12e1 SMART
IQ 1282 1304 3.73e-1 SMART
IQ 1314 1336 1.25e1 SMART
IQ 1337 1358 2.96e1 SMART
IQ 1382 1404 1.15e1 SMART
IQ 1408 1430 1.95e-4 SMART
IQ 1431 1453 4.13e1 SMART
IQ 1458 1480 1.02e-2 SMART
IQ 1496 1518 3.14e2 SMART
IQ 1519 1541 1e1 SMART
IQ 1560 1582 2.43e0 SMART
IQ 1583 1605 4.6e-1 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is the human ortholog of the Drosophila melanogaster 'abnormal spindle' gene (asp), which is essential for normal mitotic spindle function in embryonic neuroblasts. Studies in mouse also suggest a role of this gene in mitotic spindle regulation, with a preferential role in regulating neurogenesis. Mutations in this gene are associated with microcephaly primary type 5. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for protein-truncating gene trap mutations of this gene exhibit decreased body weight, microcephaly, a severe reduction in brain, testis and ovary weight, oligozoospermia and asthenospermia, and reduced fertility in both sexes. [provided by MGI curators]
Allele List at MGI

All alleles(9) : Targeted, other(2) Gene trapped(7)

Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik G T 12: 55,304,613 V236F possibly damaging Het
Aass A T 6: 23,109,498 D324E possibly damaging Het
Adam7 T C 14: 68,520,539 T245A probably benign Het
Adgrf3 G A 5: 30,197,369 Q554* probably null Het
Aim2 T C 1: 173,459,851 probably null Het
Arhgef1 G T 7: 24,925,846 D850Y probably damaging Het
C7 T C 15: 4,990,464 S734G probably benign Het
Ccdc158 A T 5: 92,623,396 S987T probably benign Het
Chrna2 G T 14: 66,143,417 G45V probably benign Het
Chrna2 C A 14: 66,143,424 Y47* probably null Het
Clec2g C A 6: 128,981,324 Q117K probably damaging Het
Cntnap5a A G 1: 116,101,574 S253G probably benign Het
Cttn T A 7: 144,457,724 D116V probably damaging Het
Cyp2c40 A G 19: 39,802,529 V286A probably benign Het
Dcbld2 T A 16: 58,465,373 S632T probably damaging Het
Dscam A T 16: 96,683,772 N1118K probably benign Het
Eif2a C T 3: 58,539,629 T92M possibly damaging Het
Frmpd1 T A 4: 45,284,382 C1068S probably benign Het
Fstl1 G A 16: 37,822,603 V110I probably benign Het
Gpat2 T C 2: 127,433,622 I465T probably damaging Het
Gpr137 C T 19: 6,940,423 probably benign Het
Hgsnat A G 8: 25,946,343 I561T probably benign Het
Ift74 T A 4: 94,652,912 probably null Het
Ilf3 A G 9: 21,403,134 probably null Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lrrc41 C A 4: 116,080,546 probably null Het
Myh11 C A 16: 14,224,059 R700L possibly damaging Het
Myo16 A G 8: 10,562,240 D1295G probably damaging Het
Myo5b A G 18: 74,740,488 M1488V probably benign Het
Naip6 A T 13: 100,299,307 Y903N probably damaging Het
Nek6 A G 2: 38,550,637 H19R probably damaging Het
Nktr A C 9: 121,741,126 T127P probably damaging Het
Noc4l A T 5: 110,649,872 D335E probably benign Het
Nsd1 A G 13: 55,301,809 D1993G probably damaging Het
Olfr1377 G A 11: 50,984,856 D52N probably damaging Het
Olfr190 A T 16: 59,074,256 F275I probably damaging Het
Pabpc2 A T 18: 39,775,530 Q616L possibly damaging Het
Pcdhga4 A T 18: 37,685,779 D127V probably damaging Het
Phrf1 T C 7: 141,259,720 probably benign Het
Phtf2 T A 5: 20,813,296 I16F probably damaging Het
Plekhg3 G T 12: 76,577,981 R1200L probably benign Het
Plod3 G C 5: 136,988,146 A50P probably benign Het
Prss12 A G 3: 123,485,485 N404D probably benign Het
Ptch2 C G 4: 117,111,206 A926G probably damaging Het
Ptpa T C 2: 30,443,305 F6L probably damaging Het
Reck T C 4: 43,942,293 I853T possibly damaging Het
Reep6 G A 10: 80,330,162 probably benign Het
Rex2 T A 4: 147,058,697 S547R probably benign Het
Rgs22 C T 15: 36,107,076 E55K probably damaging Het
Rtl6 T C 15: 84,557,001 T65A possibly damaging Het
Scarb1 G T 5: 125,277,795 P491Q probably damaging Het
Scfd1 A G 12: 51,431,519 S505G probably benign Het
Scube1 T G 15: 83,608,747 Q904P probably damaging Het
Sis T C 3: 72,921,184 Y1186C probably damaging Het
Spta1 A G 1: 174,214,066 D1334G probably benign Het
Spty2d1 T C 7: 46,998,581 E200G probably damaging Het
Stard13 C A 5: 151,092,829 probably null Het
Sybu T C 15: 44,718,943 K95R probably damaging Het
Trappc9 T A 15: 72,941,947 D488V probably damaging Het
Txk G A 5: 72,700,663 P381S probably damaging Het
Ubr2 A T 17: 46,988,722 M198K probably benign Het
Unc5a A T 13: 55,004,481 T786S possibly damaging Het
Unc93b1 G A 19: 3,941,959 R231Q probably damaging Het
Wfdc1 T A 8: 119,683,793 probably null Het
Zfp667 T G 7: 6,305,106 C258G possibly damaging Het
Zfr G A 15: 12,162,233 R823H probably benign Het
Other mutations in Aspm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00489:Aspm APN 1 139478691 missense probably damaging 1.00
IGL00594:Aspm APN 1 139487422 splice site probably benign
IGL00808:Aspm APN 1 139461476 missense probably benign 0.03
IGL00897:Aspm APN 1 139477407 missense probably damaging 0.98
IGL01024:Aspm APN 1 139478124 missense possibly damaging 0.66
IGL01410:Aspm APN 1 139482444 missense probably benign 0.25
IGL01588:Aspm APN 1 139478162 missense probably benign 0.11
IGL01610:Aspm APN 1 139489670 nonsense probably null
IGL01633:Aspm APN 1 139480836 missense possibly damaging 0.93
IGL01982:Aspm APN 1 139491588 missense probably benign 0.12
IGL02429:Aspm APN 1 139479810 missense probably benign 0.27
IGL02468:Aspm APN 1 139480950 missense probably damaging 1.00
IGL02519:Aspm APN 1 139461927 splice site probably benign
IGL02526:Aspm APN 1 139489719 missense probably benign 0.03
IGL02716:Aspm APN 1 139479687 missense probably damaging 1.00
IGL02876:Aspm APN 1 139473653 missense probably damaging 1.00
IGL02953:Aspm APN 1 139457419 missense probably benign 0.01
IGL03275:Aspm APN 1 139487295 missense probably damaging 1.00
3-1:Aspm UTSW 1 139457541 missense probably benign
R0016:Aspm UTSW 1 139479544 missense probably benign 0.01
R0016:Aspm UTSW 1 139479544 missense probably benign 0.01
R0106:Aspm UTSW 1 139476876 missense probably benign 0.02
R0106:Aspm UTSW 1 139476876 missense probably benign 0.02
R0140:Aspm UTSW 1 139480641 missense probably benign 0.00
R0195:Aspm UTSW 1 139479135 missense probably damaging 1.00
R0217:Aspm UTSW 1 139457880 missense possibly damaging 0.46
R0276:Aspm UTSW 1 139478471 missense possibly damaging 0.95
R0309:Aspm UTSW 1 139482511 splice site probably benign
R0466:Aspm UTSW 1 139477901 missense probably damaging 1.00
R0520:Aspm UTSW 1 139478820 missense possibly damaging 0.51
R0615:Aspm UTSW 1 139487289 missense probably damaging 1.00
R0626:Aspm UTSW 1 139491601 missense probably damaging 1.00
R0660:Aspm UTSW 1 139457764 missense probably benign 0.03
R0751:Aspm UTSW 1 139456898 splice site probably benign
R0830:Aspm UTSW 1 139474254 missense probably damaging 0.99
R1109:Aspm UTSW 1 139456758 missense probably damaging 0.99
R1114:Aspm UTSW 1 139461924 splice site probably benign
R1130:Aspm UTSW 1 139477834 missense possibly damaging 0.90
R1298:Aspm UTSW 1 139457419 missense probably benign 0.01
R1386:Aspm UTSW 1 139457623 missense probably benign 0.03
R1386:Aspm UTSW 1 139478972 missense possibly damaging 0.80
R1557:Aspm UTSW 1 139468668 missense probably benign 0.01
R1625:Aspm UTSW 1 139481039 missense probably benign 0.01
R1728:Aspm UTSW 1 139473574 missense probably benign
R1729:Aspm UTSW 1 139473574 missense probably benign
R1730:Aspm UTSW 1 139473574 missense probably benign
R1733:Aspm UTSW 1 139457117 missense probably benign 0.27
R1739:Aspm UTSW 1 139473574 missense probably benign
R1762:Aspm UTSW 1 139473574 missense probably benign
R1783:Aspm UTSW 1 139473574 missense probably benign
R1784:Aspm UTSW 1 139473574 missense probably benign
R1785:Aspm UTSW 1 139473574 missense probably benign
R1793:Aspm UTSW 1 139457341 missense probably benign 0.00
R1893:Aspm UTSW 1 139479867 missense probably damaging 1.00
R1911:Aspm UTSW 1 139478094 missense probably benign 0.06
R2103:Aspm UTSW 1 139491665 missense probably damaging 0.99
R2128:Aspm UTSW 1 139457635 missense probably benign 0.14
R2129:Aspm UTSW 1 139457635 missense probably benign 0.14
R2239:Aspm UTSW 1 139456846 missense possibly damaging 0.67
R2352:Aspm UTSW 1 139457562 missense probably benign 0.02
R2353:Aspm UTSW 1 139477697 missense probably damaging 1.00
R2380:Aspm UTSW 1 139479348 missense probably damaging 1.00
R2413:Aspm UTSW 1 139477757 missense probably damaging 1.00
R2421:Aspm UTSW 1 139488487 missense possibly damaging 0.49
R3607:Aspm UTSW 1 139480668 missense probably benign 0.13
R3711:Aspm UTSW 1 139458100 missense probably benign 0.17
R3718:Aspm UTSW 1 139480889 missense probably benign 0.09
R3718:Aspm UTSW 1 139490427 missense probably benign 0.31
R3741:Aspm UTSW 1 139478619 missense possibly damaging 0.47
R3788:Aspm UTSW 1 139463203 missense probably damaging 1.00
R3838:Aspm UTSW 1 139478054 missense probably benign 0.24
R3839:Aspm UTSW 1 139478054 missense probably benign 0.24
R3849:Aspm UTSW 1 139458286 missense probably benign 0.21
R4075:Aspm UTSW 1 139474285 missense probably damaging 1.00
R4463:Aspm UTSW 1 139455010 missense possibly damaging 0.95
R4537:Aspm UTSW 1 139474303 missense probably benign 0.01
R4547:Aspm UTSW 1 139478187 missense possibly damaging 0.75
R4573:Aspm UTSW 1 139479507 missense probably damaging 0.98
R4680:Aspm UTSW 1 139480671 missense probably benign 0.05
R4807:Aspm UTSW 1 139477919 missense probably damaging 1.00
R4840:Aspm UTSW 1 139470531 missense possibly damaging 0.83
R4854:Aspm UTSW 1 139478072 nonsense probably null
R4859:Aspm UTSW 1 139469393 missense probably damaging 1.00
R4893:Aspm UTSW 1 139489839 critical splice donor site probably null
R4910:Aspm UTSW 1 139491543 missense probably damaging 1.00
R4953:Aspm UTSW 1 139471734 missense probably benign 0.00
R4974:Aspm UTSW 1 139478010 missense probably benign 0.03
R4981:Aspm UTSW 1 139470760 splice site probably null
R5082:Aspm UTSW 1 139478676 nonsense probably null
R5223:Aspm UTSW 1 139478334 missense probably damaging 1.00
R5268:Aspm UTSW 1 139464295 missense probably damaging 1.00
R5371:Aspm UTSW 1 139470541 nonsense probably null
R5377:Aspm UTSW 1 139457483 missense probably damaging 0.96
R5377:Aspm UTSW 1 139470395 intron probably null
R5481:Aspm UTSW 1 139457061 missense possibly damaging 0.85
R5513:Aspm UTSW 1 139482398 missense probably damaging 1.00
R5578:Aspm UTSW 1 139470717 missense probably damaging 1.00
R5649:Aspm UTSW 1 139479669 missense probably benign
R5685:Aspm UTSW 1 139487288 missense probably benign 0.10
R5695:Aspm UTSW 1 139479669 missense probably benign
R5766:Aspm UTSW 1 139479002 missense probably damaging 0.99
R5964:Aspm UTSW 1 139455227 intron probably benign
R5993:Aspm UTSW 1 139479531 missense probably benign 0.28
R6027:Aspm UTSW 1 139463056 missense probably damaging 1.00
R6029:Aspm UTSW 1 139480990 missense possibly damaging 0.83
R6102:Aspm UTSW 1 139477459 nonsense probably null
R6188:Aspm UTSW 1 139479239 missense possibly damaging 0.79
R6257:Aspm UTSW 1 139482053 intron probably null
R6433:Aspm UTSW 1 139473683 missense probably damaging 1.00
R6682:Aspm UTSW 1 139457722 missense possibly damaging 0.67
R6763:Aspm UTSW 1 139470517 missense possibly damaging 0.64
R6798:Aspm UTSW 1 139468685 missense possibly damaging 0.66
R6815:Aspm UTSW 1 139480142 missense probably benign 0.04
R6854:Aspm UTSW 1 139463182 missense possibly damaging 0.90
R6928:Aspm UTSW 1 139480206 nonsense probably null
R6943:Aspm UTSW 1 139480542 missense probably damaging 1.00
R6979:Aspm UTSW 1 139480485 missense probably damaging 1.00
R6998:Aspm UTSW 1 139469472 missense probably damaging 1.00
R7126:Aspm UTSW 1 139480803 missense probably benign 0.27
R7237:Aspm UTSW 1 139477929 missense possibly damaging 0.81
R7240:Aspm UTSW 1 139478651 nonsense probably null
R7272:Aspm UTSW 1 139458328 missense probably benign 0.14
R7427:Aspm UTSW 1 139457616 missense probably benign 0.01
R7519:Aspm UTSW 1 139490336 missense possibly damaging 0.53
X0063:Aspm UTSW 1 139458090 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGCATGGTAAACGAGCGTC -3'
(R):5'- GCCTGGGGTGTACTTTTAGCAC -3'

Sequencing Primer
(F):5'- GCGTCAGAATAAAGCTTCGTGTCC -3'
(R):5'- CACAGTTCGTAGGATAGACTAA -3'
Posted On2017-12-01