Incidental Mutation 'R4084:Cdon'
ID500486
Institutional Source Beutler Lab
Gene Symbol Cdon
Ensembl Gene ENSMUSG00000038119
Gene Namecell adhesion molecule-related/down-regulated by oncogenes
SynonymsCDO, CAM-related/down-regulated by oncogenes
MMRRC Submission 040857-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.405) question?
Stock #R4084 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location35421128-35507652 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 35478131 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 844 (T844K)
Ref Sequence ENSEMBL: ENSMUSP00000113977 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042842] [ENSMUST00000119129]
Predicted Effect probably damaging
Transcript: ENSMUST00000042842
AA Change: T844K

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000045547
Gene: ENSMUSG00000038119
AA Change: T844K

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IGc2 40 103 1.35e-9 SMART
IG 125 212 7.25e-1 SMART
IGc2 233 296 1.38e-6 SMART
IGc2 323 386 4.62e-17 SMART
IGc2 416 506 5e-13 SMART
FN3 573 660 2.18e-2 SMART
FN3 717 800 1.89e-11 SMART
FN3 822 909 7.01e-6 SMART
transmembrane domain 962 984 N/A INTRINSIC
low complexity region 1101 1111 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000084000
Predicted Effect probably damaging
Transcript: ENSMUST00000119129
AA Change: T844K

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000113977
Gene: ENSMUSG00000038119
AA Change: T844K

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IGc2 40 103 1.35e-9 SMART
IG 125 212 7.25e-1 SMART
IGc2 233 296 1.38e-6 SMART
IGc2 323 386 4.62e-17 SMART
IGc2 416 506 5e-13 SMART
FN3 573 660 2.18e-2 SMART
FN3 717 800 1.89e-11 SMART
FN3 822 909 7.01e-6 SMART
transmembrane domain 962 984 N/A INTRINSIC
low complexity region 1101 1111 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cell surface receptor that is a member of the immunoglobulin superfamily. The encoded protein contains three fibronectin type III domains and five immunoglobulin-like C2-type domains. This protein is a member of a cell-surface receptor complex that mediates cell-cell interactions between muscle precursor cells and positively regulates myogenesis. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygous null mice display facial defects characteristic of microform holoprosencephaly, are runted, and are prone to death prior to weaning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Amotl2 A T 9: 102,724,685 probably null Het
Arhgdig T C 17: 26,199,825 D114G possibly damaging Het
Btnl1 C T 17: 34,381,159 T212I possibly damaging Het
Camkk1 C T 11: 73,037,865 T410I probably damaging Het
Capn13 C T 17: 73,337,449 G362R probably benign Het
Catsperd A G 17: 56,654,453 T392A probably benign Het
Ccdc180 A G 4: 45,950,632 I1626V probably benign Het
Col28a1 G A 6: 8,013,131 Q974* probably null Het
Col28a1 C G 6: 8,013,132 K973N possibly damaging Het
Dnhd1 T C 7: 105,709,588 L3428P probably damaging Het
Ecm1 A T 3: 95,734,363 N519K probably damaging Het
Fbxw11 T C 11: 32,739,248 V457A probably damaging Het
Flna C T X: 74,236,925 V1009M possibly damaging Het
Fmnl2 A T 2: 53,107,495 K486I possibly damaging Het
Gja1 A C 10: 56,388,511 Q322P possibly damaging Het
Gm14124 T A 2: 150,266,202 N27K possibly damaging Het
Gtpbp3 A G 8: 71,490,512 Q189R probably benign Het
H2-Eb1 T C 17: 34,314,443 V213A probably damaging Het
Herc4 G T 10: 63,283,237 G322V probably damaging Het
Hgf G T 5: 16,615,858 G668* probably null Het
Htra1 T C 7: 130,936,344 S25P probably benign Het
Ifi44 A G 3: 151,745,489 probably null Het
Klhl24 T A 16: 20,114,562 S308T probably damaging Het
Lamb2 A G 9: 108,488,018 N1291S probably benign Het
Lgals9 A T 11: 78,969,763 F162Y possibly damaging Het
Lig3 T A 11: 82,795,424 I634N probably damaging Het
Lipn T C 19: 34,078,940 F229L probably benign Het
Lmtk3 T A 7: 45,793,292 S466R probably damaging Het
Lonrf2 G A 1: 38,821,151 T22I probably benign Het
Macf1 T C 4: 123,450,072 H2119R probably damaging Het
Muc6 C T 7: 141,648,655 C634Y probably damaging Het
Nap1l1 G A 10: 111,490,077 V86I possibly damaging Het
Noxred1 A G 12: 87,233,484 Y25H possibly damaging Het
Nphp4 T C 4: 152,488,791 L62P probably damaging Het
Olfr1359 G A 13: 21,703,068 W22* probably null Het
Olfr1359 C A 13: 21,703,069 L23M probably damaging Het
Olfr599 T G 7: 103,338,320 F89V probably damaging Het
Olfr745 T A 14: 50,642,848 I189N probably damaging Het
Pcdh10 A C 3: 45,392,707 D979A probably damaging Het
Pla2g4f C G 2: 120,312,325 Q101H probably benign Het
Ppp1r15b T C 1: 133,133,067 F441L probably damaging Het
Prkaca C A 8: 83,995,310 P309T probably damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Ripor3 A G 2: 167,984,466 Y720H possibly damaging Het
Rpgrip1 A G 14: 52,149,351 E751G possibly damaging Het
Rsf1 GCGGCGGCGGCGGCGGC GCGGCGGCGGCGGCGGCGGCGGCGGC 7: 97,579,919 probably benign Het
Ryr3 A G 2: 112,900,908 S686P probably damaging Het
Seh1l T C 18: 67,788,790 V240A possibly damaging Het
Slc10a2 T G 8: 5,089,126 I273L possibly damaging Het
Slc23a2 A T 2: 132,091,217 L107* probably null Het
Slc44a4 T C 17: 34,917,347 L38P probably damaging Het
Slc6a18 C T 13: 73,667,029 V387I probably benign Het
Slu7 G A 11: 43,443,391 A415T probably benign Het
Tlr5 A T 1: 182,974,848 R572S possibly damaging Het
Tmem45a2 C T 16: 57,071,024 G3D probably benign Het
Trim24 A G 6: 37,915,257 T242A probably damaging Het
Triobp T A 15: 78,973,671 N1157K probably benign Het
Ugt1a6a A T 1: 88,139,177 D235V probably benign Het
Vmn2r37 C T 7: 9,215,985 V467I probably benign Het
Vmn2r7 C T 3: 64,692,993 E495K probably benign Het
Vstm2a A G 11: 16,263,098 E161G probably damaging Het
Ypel3 T C 7: 126,778,365 V74A possibly damaging Het
Zfp27 C T 7: 29,895,367 R391H possibly damaging Het
Other mutations in Cdon
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00832:Cdon APN 9 35478116 missense probably damaging 1.00
IGL01307:Cdon APN 9 35457564 missense probably benign 0.01
IGL01528:Cdon APN 9 35470107 missense possibly damaging 0.95
IGL01663:Cdon APN 9 35483214 missense possibly damaging 0.57
IGL01723:Cdon APN 9 35503338 missense probably benign 0.05
IGL02200:Cdon APN 9 35483109 missense probably benign 0.28
IGL02444:Cdon APN 9 35473448 missense probably benign 0.09
IGL02547:Cdon APN 9 35478654 missense probably damaging 1.00
IGL02620:Cdon APN 9 35452799 missense probably benign 0.00
IGL02861:Cdon APN 9 35486957 missense probably damaging 0.96
IGL02894:Cdon APN 9 35455426 missense probably benign 0.01
IGL03153:Cdon APN 9 35477959 missense probably damaging 1.00
IGL03206:Cdon APN 9 35503306 missense probably benign
IGL03374:Cdon APN 9 35478003 missense possibly damaging 0.46
indentured UTSW 9 35452106 start codon destroyed probably null 1.00
Molar UTSW 9 35463895 missense probably benign 0.15
PIT4280001:Cdon UTSW 9 35486935 missense probably damaging 1.00
R0045:Cdon UTSW 9 35486807 missense probably benign
R0045:Cdon UTSW 9 35486807 missense probably benign
R0064:Cdon UTSW 9 35489227 missense probably benign 0.03
R0396:Cdon UTSW 9 35470130 missense probably damaging 1.00
R0403:Cdon UTSW 9 35473500 missense probably benign 0.00
R0490:Cdon UTSW 9 35452682 missense probably damaging 1.00
R0547:Cdon UTSW 9 35457498 missense possibly damaging 0.88
R0609:Cdon UTSW 9 35478611 missense probably damaging 1.00
R0645:Cdon UTSW 9 35477083 splice site probably null
R0781:Cdon UTSW 9 35456437 splice site probably benign
R1110:Cdon UTSW 9 35456437 splice site probably benign
R1391:Cdon UTSW 9 35504189 missense possibly damaging 0.51
R1574:Cdon UTSW 9 35452937 splice site probably benign
R1851:Cdon UTSW 9 35483158 missense probably damaging 1.00
R2031:Cdon UTSW 9 35504074 missense probably damaging 0.96
R2230:Cdon UTSW 9 35491926 critical splice donor site probably null
R3683:Cdon UTSW 9 35489032 missense possibly damaging 0.89
R3684:Cdon UTSW 9 35489032 missense possibly damaging 0.89
R3685:Cdon UTSW 9 35489032 missense possibly damaging 0.89
R3941:Cdon UTSW 9 35464171 missense probably benign 0.09
R4030:Cdon UTSW 9 35491906 missense probably damaging 1.00
R4462:Cdon UTSW 9 35457580 missense probably damaging 0.97
R4569:Cdon UTSW 9 35476969 missense probably damaging 1.00
R4677:Cdon UTSW 9 35478605 missense probably damaging 1.00
R4869:Cdon UTSW 9 35452904 missense possibly damaging 0.71
R5032:Cdon UTSW 9 35489034 missense probably damaging 1.00
R5047:Cdon UTSW 9 35478639 missense probably damaging 1.00
R5214:Cdon UTSW 9 35483208 missense probably damaging 1.00
R5341:Cdon UTSW 9 35470135 missense probably damaging 1.00
R5410:Cdon UTSW 9 35470035 missense probably damaging 0.99
R5581:Cdon UTSW 9 35504081 missense probably benign 0.01
R5696:Cdon UTSW 9 35491866 missense possibly damaging 0.69
R5757:Cdon UTSW 9 35452772 missense probably damaging 0.98
R5802:Cdon UTSW 9 35454420 missense probably damaging 0.99
R5845:Cdon UTSW 9 35457466 missense probably damaging 1.00
R5949:Cdon UTSW 9 35486951 missense probably benign 0.32
R6106:Cdon UTSW 9 35455408 nonsense probably null
R6245:Cdon UTSW 9 35476939 missense probably damaging 1.00
R6845:Cdon UTSW 9 35486956 nonsense probably null
R6896:Cdon UTSW 9 35452106 start codon destroyed probably null 1.00
R7060:Cdon UTSW 9 35486909 missense probably damaging 1.00
R7076:Cdon UTSW 9 35504150 missense probably benign 0.00
R7184:Cdon UTSW 9 35463895 missense probably benign 0.15
R7382:Cdon UTSW 9 35478648 missense probably damaging 1.00
R7763:Cdon UTSW 9 35454415 nonsense probably null
R7857:Cdon UTSW 9 35456612 missense possibly damaging 0.79
R7885:Cdon UTSW 9 35456522 missense probably benign 0.01
R7894:Cdon UTSW 9 35476948 missense probably damaging 1.00
R7940:Cdon UTSW 9 35456612 missense possibly damaging 0.79
R7968:Cdon UTSW 9 35456522 missense probably benign 0.01
R7977:Cdon UTSW 9 35476948 missense probably damaging 1.00
Z1177:Cdon UTSW 9 35491900 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTGGAACCAAGTAACATTTTCTG -3'
(R):5'- GCAGAAGAAACTGTGGTGCC -3'

Sequencing Primer
(F):5'- TTTCTGAACTGAAAGCTTTCCAG -3'
(R):5'- GAAACTGTGGTGCCATTTTTAACCC -3'
Posted On2017-12-01