Incidental Mutation 'R0543:Col28a1'
ID50049
Institutional Source Beutler Lab
Gene Symbol Col28a1
Ensembl Gene ENSMUSG00000068794
Gene Namecollagen, type XXVIII, alpha 1
SynonymsCol28; Gm466
MMRRC Submission 038735-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R0543 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location7997808-8192617 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 8075326 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000111199 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115537]
Predicted Effect probably benign
Transcript: ENSMUST00000115537
SMART Domains Protein: ENSMUSP00000111199
Gene: ENSMUSG00000068794

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
VWA 46 225 8.08e-18 SMART
low complexity region 245 260 N/A INTRINSIC
internal_repeat_1 261 304 1.56e-15 PROSPERO
low complexity region 306 363 N/A INTRINSIC
low complexity region 375 422 N/A INTRINSIC
low complexity region 438 479 N/A INTRINSIC
internal_repeat_4 481 531 4.11e-8 PROSPERO
Pfam:Collagen 534 591 1.5e-8 PFAM
low complexity region 640 661 N/A INTRINSIC
low complexity region 667 684 N/A INTRINSIC
internal_repeat_4 690 739 4.11e-8 PROSPERO
internal_repeat_1 711 763 1.56e-15 PROSPERO
internal_repeat_5 713 769 4.35e-6 PROSPERO
low complexity region 771 789 N/A INTRINSIC
VWA 796 973 1.57e-38 SMART
KU 1086 1139 8.16e-20 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123163
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.3%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] COL28A1 belongs to a class of collagens containing von Willebrand factor (VWF; MIM 613160) type A (VWFA) domains (Veit et al., 2006 [PubMed 16330543]).[supplied by OMIM, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1500015O10Rik C A 1: 43,742,289 N110K possibly damaging Het
4930444G20Rik T C 10: 22,066,924 S386G possibly damaging Het
4932438A13Rik G A 3: 36,996,458 S2981N probably benign Het
Alox5 T A 6: 116,454,317 probably null Het
Apol9b A G 15: 77,735,640 N212S probably damaging Het
Ash1l T A 3: 89,063,778 probably null Het
Ccdc180 A T 4: 45,900,041 K200* probably null Het
Ccser2 A T 14: 36,940,192 M345K probably benign Het
Cdcp2 A T 4: 107,097,676 probably null Het
Clca3a1 T C 3: 144,748,394 probably benign Het
Cntn3 G A 6: 102,269,090 probably benign Het
Dock2 A G 11: 34,294,325 F1035S probably damaging Het
Dsg1a A T 18: 20,340,863 S998C probably damaging Het
Enox1 T C 14: 77,506,959 probably benign Het
Fgfr3 A G 5: 33,729,710 M1V probably null Het
Fuca2 T A 10: 13,503,126 Y5N probably damaging Het
Git2 G T 5: 114,745,531 H42Q probably damaging Het
Gm7964 G A 7: 83,756,394 noncoding transcript Het
Hars2 G A 18: 36,789,424 E337K probably damaging Het
Hells A G 19: 38,967,750 R797G probably benign Het
Hnf1a G A 5: 114,950,744 S571L probably benign Het
Hoxa5 T C 6: 52,204,340 Y4C probably damaging Het
Inpp4a G A 1: 37,369,492 probably benign Het
Ints6 T C 14: 62,696,611 I816V probably damaging Het
Itpr1 T C 6: 108,515,748 probably benign Het
Kcnt2 C A 1: 140,609,614 P1037T probably damaging Het
Lyg2 T A 1: 37,911,107 M47L possibly damaging Het
Macf1 G T 4: 123,376,378 A4648D probably damaging Het
Mcf2l T C 8: 12,996,728 probably null Het
Mcm9 C T 10: 53,541,598 R3H probably damaging Het
Met T A 6: 17,491,970 Y244N probably damaging Het
Mettl14 A T 3: 123,374,762 C210S possibly damaging Het
Mrgpra4 T C 7: 47,981,310 Y181C probably benign Het
Mtch2 T C 2: 90,849,682 V86A possibly damaging Het
Mttp A T 3: 138,111,696 I446N possibly damaging Het
Muc4 T A 16: 32,756,746 S2207T unknown Het
Muc5b A G 7: 141,851,785 T944A unknown Het
Myo15 A T 11: 60,479,051 H879L probably benign Het
Nkiras2 G A 11: 100,624,192 probably benign Het
Nostrin T G 2: 69,189,131 *507E probably null Het
Nup205 T C 6: 35,198,969 V589A probably benign Het
Olfr1141 C A 2: 87,753,650 L114F probably damaging Het
Olfr1444 G T 19: 12,861,888 V38F probably benign Het
Olfr530 A G 7: 140,373,394 I72T probably benign Het
Oxct2b T A 4: 123,116,989 M234K possibly damaging Het
Park2 G A 17: 11,067,179 D20N probably damaging Het
Pcdha1 A T 18: 37,185,068 I945F probably damaging Het
Pdzd3 A C 9: 44,248,934 H324Q probably damaging Het
Pik3ca G A 3: 32,450,261 probably null Het
Pkhd1l1 A G 15: 44,523,491 probably null Het
Plscr1 A T 9: 92,258,046 probably null Het
Psd T C 19: 46,319,517 E684G possibly damaging Het
Rab11fip3 T C 17: 25,994,225 E870G probably damaging Het
Rpl22l1 C A 3: 28,807,274 Y103* probably null Het
Slc38a4 A T 15: 97,016,839 N44K possibly damaging Het
Slco6c1 T A 1: 97,127,898 I93F probably damaging Het
Ssfa2 T A 2: 79,644,506 S270T possibly damaging Het
Strip1 G A 3: 107,626,775 T181M possibly damaging Het
Stxbp5l G A 16: 37,208,096 A535V probably damaging Het
Tg A T 15: 66,729,597 Q152L probably benign Het
Thada T C 17: 84,423,163 T1036A probably damaging Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Tns1 T A 1: 73,952,697 T941S probably benign Het
Tppp3 T C 8: 105,468,208 D97G probably benign Het
Trp53bp1 C A 2: 121,251,868 A317S probably null Het
Trpm7 T C 2: 126,848,529 I210V probably damaging Het
Ubr1 A G 2: 120,881,093 L1440P probably damaging Het
Utp18 A T 11: 93,875,835 Y317N probably damaging Het
Zdhhc5 T A 2: 84,692,480 probably benign Het
Zfp719 A G 7: 43,589,253 probably null Het
Other mutations in Col28a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Col28a1 APN 6 8014795 missense probably damaging 1.00
IGL00329:Col28a1 APN 6 8175425 missense probably damaging 1.00
IGL00466:Col28a1 APN 6 8022081 splice site probably benign
IGL00544:Col28a1 APN 6 8162228 critical splice acceptor site probably null
IGL00979:Col28a1 APN 6 8014810 missense probably damaging 1.00
IGL01475:Col28a1 APN 6 8103521 missense probably damaging 0.98
IGL01570:Col28a1 APN 6 8014540 missense probably damaging 0.99
IGL01688:Col28a1 APN 6 7998517 missense probably damaging 1.00
IGL01734:Col28a1 APN 6 8158134 missense probably damaging 0.99
IGL01911:Col28a1 APN 6 8014963 missense probably damaging 1.00
IGL01922:Col28a1 APN 6 8158133 missense probably damaging 0.96
IGL02567:Col28a1 APN 6 8014819 missense possibly damaging 0.91
IGL02641:Col28a1 APN 6 8014794 nonsense probably null
IGL02893:Col28a1 APN 6 8103534 missense probably damaging 1.00
IGL03062:Col28a1 APN 6 8017029 splice site probably benign
IGL03273:Col28a1 APN 6 8103484 splice site probably benign
P0043:Col28a1 UTSW 6 8168152 unclassified probably benign
R0034:Col28a1 UTSW 6 8175708 missense probably benign 0.32
R0646:Col28a1 UTSW 6 8175291 missense possibly damaging 0.88
R0726:Col28a1 UTSW 6 8014495 critical splice donor site probably null
R1013:Col28a1 UTSW 6 7999452 splice site probably benign
R1054:Col28a1 UTSW 6 8175534 missense probably damaging 0.96
R1671:Col28a1 UTSW 6 8083773 missense possibly damaging 0.84
R1804:Col28a1 UTSW 6 8164612 critical splice donor site probably null
R1853:Col28a1 UTSW 6 8014574 missense probably benign 0.03
R1906:Col28a1 UTSW 6 7999644 missense probably benign 0.14
R1914:Col28a1 UTSW 6 8176333 missense probably benign 0.08
R1915:Col28a1 UTSW 6 8176333 missense probably benign 0.08
R1954:Col28a1 UTSW 6 7998516 missense probably damaging 1.00
R1997:Col28a1 UTSW 6 7999644 missense probably benign 0.14
R2011:Col28a1 UTSW 6 8059360 missense probably benign 0.05
R2023:Col28a1 UTSW 6 8083783 missense possibly damaging 0.66
R2149:Col28a1 UTSW 6 8155383 missense possibly damaging 0.83
R2285:Col28a1 UTSW 6 8097078 missense probably damaging 0.98
R2403:Col28a1 UTSW 6 8175641 missense possibly damaging 0.79
R3615:Col28a1 UTSW 6 8014942 missense probably damaging 1.00
R3616:Col28a1 UTSW 6 8014942 missense probably damaging 1.00
R3837:Col28a1 UTSW 6 8014601 missense possibly damaging 0.81
R4042:Col28a1 UTSW 6 8014678 missense probably damaging 0.98
R4084:Col28a1 UTSW 6 8013131 nonsense probably null
R4084:Col28a1 UTSW 6 8013132 missense possibly damaging 0.49
R4417:Col28a1 UTSW 6 8175666 missense possibly damaging 0.62
R4838:Col28a1 UTSW 6 8014559 missense probably benign 0.11
R5752:Col28a1 UTSW 6 8015025 missense possibly damaging 0.79
R5807:Col28a1 UTSW 6 8158144 missense probably benign 0.00
R6038:Col28a1 UTSW 6 8013140 missense probably benign 0.03
R6038:Col28a1 UTSW 6 8013140 missense probably benign 0.03
R6046:Col28a1 UTSW 6 8168102 splice site probably null
R6054:Col28a1 UTSW 6 8083748 missense possibly damaging 0.96
R6159:Col28a1 UTSW 6 8162247 intron probably null
R6306:Col28a1 UTSW 6 8014969 missense probably damaging 0.96
R6379:Col28a1 UTSW 6 8012996 missense probably benign 0.00
R6665:Col28a1 UTSW 6 8062277 missense probably benign 0.08
R6809:Col28a1 UTSW 6 7999468 missense probably damaging 0.99
R7023:Col28a1 UTSW 6 8083763 missense possibly damaging 0.92
R7101:Col28a1 UTSW 6 8014795 missense possibly damaging 0.95
R7117:Col28a1 UTSW 6 8013122 missense possibly damaging 0.89
R7375:Col28a1 UTSW 6 7998499 missense possibly damaging 0.46
Z1177:Col28a1 UTSW 6 8062283 missense possibly damaging 0.52
Z1177:Col28a1 UTSW 6 8127352 missense probably damaging 1.00
Z1177:Col28a1 UTSW 6 8175630 missense unknown
Predicted Primers PCR Primer
(F):5'- TTCATAGGCACATTTCCCAGGAAGC -3'
(R):5'- CTCCAGGACTCAAAGGTGATGGC -3'

Sequencing Primer
(F):5'- TTTCCCAGGAAGCCCATGAG -3'
(R):5'- tttcctctttctctccttccttc -3'
Posted On2013-06-12