Incidental Mutation 'R4094:Abca6'
ID500491
Institutional Source Beutler Lab
Gene Symbol Abca6
Ensembl Gene ENSMUSG00000044749
Gene NameATP-binding cassette, sub-family A (ABC1), member 6
Synonyms6330565N06Rik
MMRRC Submission 041628-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4094 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location110176820-110251776 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 110180366 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 1500 (C1500R)
Ref Sequence ENSEMBL: ENSMUSP00000035458 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044003]
Predicted Effect probably damaging
Transcript: ENSMUST00000044003
AA Change: C1500R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000035458
Gene: ENSMUSG00000044749
AA Change: C1500R

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 28 416 1.4e-42 PFAM
low complexity region 484 495 N/A INTRINSIC
AAA 506 691 1.13e-6 SMART
transmembrane domain 854 876 N/A INTRINSIC
transmembrane domain 971 990 N/A INTRINSIC
transmembrane domain 1005 1027 N/A INTRINSIC
Blast:AAA 1041 1176 4e-21 BLAST
transmembrane domain 1191 1213 N/A INTRINSIC
low complexity region 1243 1254 N/A INTRINSIC
AAA 1312 1505 2.43e-6 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, and White). This encoded protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. This gene is clustered among 4 other ABC1 family members on 17q24 and may play a role in macrophage lipid homeostasis. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Amz1 A T 5: 140,752,166 M93L probably damaging Het
Asb18 A T 1: 90,014,425 N51K probably damaging Het
Bcl11b G T 12: 107,916,835 P335Q probably damaging Het
Bsn A C 9: 108,113,870 V1561G probably damaging Het
Cadm2 A T 16: 66,882,797 N49K probably damaging Het
Cct8 T G 16: 87,487,628 I283L possibly damaging Het
Cdc25b A G 2: 131,189,117 M121V probably benign Het
Cpne4 A G 9: 104,686,535 D37G probably damaging Het
Cym A G 3: 107,214,266 S237P probably benign Het
Dhx35 T A 2: 158,842,356 I517N probably damaging Het
Ehf T C 2: 103,290,750 probably benign Het
Erp29 A G 5: 121,452,282 probably benign Het
Fam160a2 T C 7: 105,388,218 D386G probably damaging Het
Fgd6 C A 10: 94,043,434 P50Q probably damaging Het
Foxn3 G T 12: 99,196,441 D400E probably damaging Het
Frmd4a A G 2: 4,611,032 Y1031C probably damaging Het
Gna13 T A 11: 109,396,416 I355N probably damaging Het
Hgs T A 11: 120,469,033 L21* probably null Het
Htr2a G A 14: 74,706,349 M456I probably benign Het
Itga2 T C 13: 114,870,625 D389G probably benign Het
Kdm1b T C 13: 47,063,020 C289R probably damaging Het
Kdm4c T A 4: 74,311,678 D237E probably benign Het
Lilr4b A T 10: 51,481,410 E114V probably damaging Het
Loxl1 G A 9: 58,312,456 T144I probably damaging Het
Macf1 C T 4: 123,459,269 R1784Q probably benign Het
Maml2 G A 9: 13,620,153 S221N probably benign Het
Map3k1 A G 13: 111,756,162 M853T possibly damaging Het
Micu3 T G 8: 40,335,888 S147A probably null Het
Nccrp1 T C 7: 28,544,226 Y261C possibly damaging Het
Olfr1030 A G 2: 85,984,218 Y126C probably damaging Het
Olfr1049 T C 2: 86,255,330 D121G probably damaging Het
Olfr282 T C 15: 98,437,682 L71P probably damaging Het
Olfr611 T A 7: 103,518,037 I116F possibly damaging Het
Pclo C A 5: 14,855,645 T4963N unknown Het
Pdxk T C 10: 78,464,810 H13R probably damaging Het
Plcg1 A G 2: 160,747,841 E95G probably damaging Het
Ppargc1a T C 5: 51,490,064 N276S possibly damaging Het
Prr12 A G 7: 45,047,947 L848P unknown Het
Ptcd2 A G 13: 99,332,449 I202T probably damaging Het
Rab27a A C 9: 73,075,544 I44L probably damaging Het
Rbfox2 A T 15: 77,132,725 S82T probably damaging Het
Rsbn1 T A 3: 103,928,658 F337L probably damaging Het
Samd8 T C 14: 21,793,045 I414T probably damaging Het
Sema3e A G 5: 14,233,690 I478V probably benign Het
Sfswap A G 5: 129,560,741 S821G possibly damaging Het
Slc2a3 A T 6: 122,735,568 I239N probably benign Het
Spc25 G A 2: 69,202,631 S50L probably damaging Het
St8sia4 A T 1: 95,627,686 S206R possibly damaging Het
Syngr3 G A 17: 24,689,843 probably benign Het
Tigd4 A G 3: 84,594,640 D288G probably damaging Het
Trim34b A G 7: 104,334,588 M251V probably benign Het
Ttll5 A T 12: 85,956,602 R214* probably null Het
Ttn T C 2: 76,900,516 probably benign Het
Vmp1 A G 11: 86,643,580 I167T probably benign Het
Zfp64 T C 2: 168,925,935 T586A probably benign Het
Zfp943 T A 17: 21,992,982 C350S probably damaging Het
Zscan4f A T 7: 11,401,258 N197I probably damaging Het
Other mutations in Abca6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Abca6 APN 11 110184709 missense probably damaging 1.00
IGL00569:Abca6 APN 11 110187049 missense possibly damaging 0.88
IGL00737:Abca6 APN 11 110196997 splice site probably benign
IGL01024:Abca6 APN 11 110197142 missense probably benign
IGL01087:Abca6 APN 11 110191650 missense probably benign 0.00
IGL01511:Abca6 APN 11 110244310 missense probably benign 0.00
IGL01516:Abca6 APN 11 110218217 missense possibly damaging 0.70
IGL01621:Abca6 APN 11 110184708 missense probably damaging 1.00
IGL01749:Abca6 APN 11 110244224 missense probably damaging 1.00
IGL01934:Abca6 APN 11 110188655 missense probably benign 0.00
IGL02010:Abca6 APN 11 110219616 missense probably benign 0.12
IGL02121:Abca6 APN 11 110182924 missense probably benign 0.38
IGL02423:Abca6 APN 11 110219006 splice site probably benign
IGL02428:Abca6 APN 11 110178792 missense possibly damaging 0.81
IGL02491:Abca6 APN 11 110176968 utr 3 prime probably benign
IGL02541:Abca6 APN 11 110212267 missense probably damaging 1.00
IGL02792:Abca6 APN 11 110188681 missense probably damaging 0.99
IGL02836:Abca6 APN 11 110248548 missense probably damaging 1.00
IGL02965:Abca6 APN 11 110180613 missense probably benign
IGL03094:Abca6 APN 11 110184112 missense probably benign 0.03
IGL03109:Abca6 APN 11 110180347 missense probably damaging 0.96
R0068:Abca6 UTSW 11 110182882 missense probably damaging 1.00
R0142:Abca6 UTSW 11 110188641 missense probably damaging 1.00
R0165:Abca6 UTSW 11 110219604 missense possibly damaging 0.90
R0254:Abca6 UTSW 11 110236789 missense probably benign 0.16
R0598:Abca6 UTSW 11 110197154 missense probably damaging 1.00
R0992:Abca6 UTSW 11 110211684 missense probably damaging 1.00
R1386:Abca6 UTSW 11 110244255 missense probably benign 0.02
R1642:Abca6 UTSW 11 110218281 missense possibly damaging 0.73
R1673:Abca6 UTSW 11 110212339 missense probably benign 0.01
R1792:Abca6 UTSW 11 110184044 missense probably benign 0.00
R1813:Abca6 UTSW 11 110233845 splice site probably benign
R1817:Abca6 UTSW 11 110219318 missense probably benign 0.00
R1842:Abca6 UTSW 11 110197039 missense probably benign 0.00
R1898:Abca6 UTSW 11 110208799 missense probably damaging 0.99
R1914:Abca6 UTSW 11 110212210 missense probably benign 0.06
R1915:Abca6 UTSW 11 110212210 missense probably benign 0.06
R1934:Abca6 UTSW 11 110210083 critical splice donor site probably null
R1964:Abca6 UTSW 11 110184676 missense probably damaging 0.98
R1967:Abca6 UTSW 11 110187148 missense probably benign 0.09
R2127:Abca6 UTSW 11 110219649 missense probably benign 0.00
R2128:Abca6 UTSW 11 110219649 missense probably benign 0.00
R2164:Abca6 UTSW 11 110210193 frame shift probably null
R2895:Abca6 UTSW 11 110202426 missense probably benign 0.00
R3110:Abca6 UTSW 11 110178829 nonsense probably null
R3111:Abca6 UTSW 11 110178829 nonsense probably null
R3112:Abca6 UTSW 11 110178829 nonsense probably null
R4432:Abca6 UTSW 11 110241588 missense probably benign 0.11
R4474:Abca6 UTSW 11 110233772 missense possibly damaging 0.46
R4572:Abca6 UTSW 11 110216548 missense probably benign 0.31
R4629:Abca6 UTSW 11 110230549 critical splice acceptor site probably null
R4793:Abca6 UTSW 11 110191718 missense probably benign
R4852:Abca6 UTSW 11 110244203 missense probably benign 0.09
R4867:Abca6 UTSW 11 110202379 missense probably benign 0.01
R4879:Abca6 UTSW 11 110219700 missense probably damaging 0.98
R4918:Abca6 UTSW 11 110180551 missense probably damaging 1.00
R5060:Abca6 UTSW 11 110219604 missense possibly damaging 0.90
R5062:Abca6 UTSW 11 110177066 missense probably benign 0.12
R5083:Abca6 UTSW 11 110218967 missense probably damaging 1.00
R5173:Abca6 UTSW 11 110191720 missense probably benign
R5393:Abca6 UTSW 11 110244295 missense probably benign 0.00
R5484:Abca6 UTSW 11 110184073 missense probably damaging 1.00
R5498:Abca6 UTSW 11 110208844 missense possibly damaging 0.95
R5503:Abca6 UTSW 11 110218257 missense probably damaging 1.00
R5645:Abca6 UTSW 11 110250408 missense probably damaging 0.99
R5680:Abca6 UTSW 11 110236645 missense possibly damaging 0.88
R5761:Abca6 UTSW 11 110210101 missense probably damaging 1.00
R5779:Abca6 UTSW 11 110184670 missense probably benign 0.37
R5818:Abca6 UTSW 11 110219643 missense probably damaging 1.00
R6282:Abca6 UTSW 11 110208824 missense probably damaging 0.98
R6455:Abca6 UTSW 11 110241581 missense probably damaging 1.00
R6826:Abca6 UTSW 11 110216605 missense probably benign 0.15
R6857:Abca6 UTSW 11 110219688 missense possibly damaging 0.63
R6914:Abca6 UTSW 11 110190238 missense probably benign
R6931:Abca6 UTSW 11 110244328 missense probably benign 0.27
R7222:Abca6 UTSW 11 110191693 missense probably benign 0.29
R7242:Abca6 UTSW 11 110241653 missense possibly damaging 0.47
R7297:Abca6 UTSW 11 110183026 critical splice donor site probably null
R7387:Abca6 UTSW 11 110202420 missense probably benign
R7420:Abca6 UTSW 11 110250477 missense probably benign 0.24
R7494:Abca6 UTSW 11 110208745 missense possibly damaging 0.93
X0024:Abca6 UTSW 11 110244255 missense probably benign 0.02
X0064:Abca6 UTSW 11 110197142 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CCACGGTGCTAACAGACATC -3'
(R):5'- AGCAGCCATCATGGTGTCTG -3'

Sequencing Primer
(F):5'- CTAACAGACATCGCAGCGTGTG -3'
(R):5'- CCATCATGGTGTCTGGAAGGC -3'
Posted On2017-12-01