Incidental Mutation 'R4201:Gse1'
ID500500
Institutional Source Beutler Lab
Gene Symbol Gse1
Ensembl Gene ENSMUSG00000031822
Gene Namegenetic suppressor element 1, coiled-coil protein
Synonyms
MMRRC Submission 041031-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.166) question?
Stock #R4201 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location120228456-120581390 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 120567764 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 277 (M277L)
Ref Sequence ENSEMBL: ENSMUSP00000034279 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034279] [ENSMUST00000118136] [ENSMUST00000120493] [ENSMUST00000127664]
Predicted Effect probably benign
Transcript: ENSMUST00000034279
AA Change: M277L

PolyPhen 2 Score 0.387 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000034279
Gene: ENSMUSG00000031822
AA Change: M277L

DomainStartEndE-ValueType
low complexity region 61 73 N/A INTRINSIC
Pfam:DUF3736 81 216 2.9e-21 PFAM
coiled coil region 329 414 N/A INTRINSIC
Pfam:DUF3736 742 883 9.7e-46 PFAM
low complexity region 959 973 N/A INTRINSIC
low complexity region 1103 1124 N/A INTRINSIC
coiled coil region 1133 1207 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118136
AA Change: M267L

PolyPhen 2 Score 0.268 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000112981
Gene: ENSMUSG00000031822
AA Change: M267L

DomainStartEndE-ValueType
low complexity region 51 63 N/A INTRINSIC
Pfam:DUF3736 70 203 2.2e-39 PFAM
low complexity region 204 211 N/A INTRINSIC
coiled coil region 319 404 N/A INTRINSIC
Pfam:DUF3736 731 874 7.5e-48 PFAM
low complexity region 949 963 N/A INTRINSIC
low complexity region 1093 1114 N/A INTRINSIC
coiled coil region 1123 1197 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120493
AA Change: M264L

PolyPhen 2 Score 0.268 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000113577
Gene: ENSMUSG00000031822
AA Change: M264L

DomainStartEndE-ValueType
low complexity region 48 60 N/A INTRINSIC
Pfam:DUF3736 67 200 2.2e-39 PFAM
low complexity region 201 208 N/A INTRINSIC
coiled coil region 316 401 N/A INTRINSIC
Pfam:DUF3736 728 871 7.5e-48 PFAM
low complexity region 946 960 N/A INTRINSIC
low complexity region 1090 1111 N/A INTRINSIC
coiled coil region 1120 1194 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141113
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147327
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211997
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik A G 18: 6,623,952 probably null Het
Als2 A T 1: 59,180,154 D1212E possibly damaging Het
Arfgef3 A G 10: 18,619,782 S1167P probably benign Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Atp1b2 A G 11: 69,603,469 V66A possibly damaging Het
Bag3 C A 7: 128,546,157 L499I probably damaging Het
Boc T C 16: 44,490,618 D751G probably damaging Het
Camk1d T C 2: 5,354,776 Y145C probably benign Het
Ccdc172 G A 19: 58,536,585 R158H probably benign Het
Cd101 A C 3: 101,018,685 D239E probably damaging Het
Cd9 T C 6: 125,462,394 D125G possibly damaging Het
Cep295 T C 9: 15,332,538 I1493V probably benign Het
Chrna5 A G 9: 54,998,075 D57G probably benign Het
Cul7 C T 17: 46,661,312 R1201W probably damaging Het
Dnah1 A G 14: 31,262,270 V3976A probably benign Het
Dnah11 T C 12: 117,966,659 D3317G possibly damaging Het
Dnmt3b G T 2: 153,670,417 E353* probably null Het
Gch1 T C 14: 47,155,803 S241G probably benign Het
Gpr22 A T 12: 31,708,913 Y366* probably null Het
Kcnt2 G A 1: 140,425,332 V260I probably damaging Het
Nbas G T 12: 13,374,826 C1022F probably benign Het
Nfix CAAAAA CAAAA 8: 84,716,247 probably null Het
Olfr776 T C 10: 129,261,777 V272A probably benign Het
Olfr807 A T 10: 129,754,628 L274H probably damaging Het
Parp4 C A 14: 56,592,391 T274K possibly damaging Het
Pgs1 A G 11: 118,002,536 S230G probably damaging Het
Plin4 T G 17: 56,104,338 T898P probably damaging Het
Ptprj A C 2: 90,463,095 V548G probably damaging Het
Sec23a T C 12: 59,002,005 I139M probably benign Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Stx17 T A 4: 48,158,870 D83E probably damaging Het
Syne1 A T 10: 5,347,870 D1142E probably benign Het
Tbccd1 A G 16: 22,825,948 V226A probably damaging Het
Tex11 C A X: 100,933,415 A487S possibly damaging Het
Tmed7 A G 18: 46,593,247 probably null Het
Tnfrsf23 A T 7: 143,670,054 C137S probably damaging Het
Vmn2r87 T C 10: 130,472,579 I597V probably benign Het
Other mutations in Gse1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01407:Gse1 APN 8 120553587 start codon destroyed probably null 0.79
IGL02484:Gse1 APN 8 120575262 intron probably benign
IGL02931:Gse1 APN 8 120578069 intron probably benign
IGL03193:Gse1 APN 8 120571340 critical splice donor site probably null
R0027:Gse1 UTSW 8 120566546 intron probably benign
R0109:Gse1 UTSW 8 120567785 missense probably damaging 1.00
R0257:Gse1 UTSW 8 120572334 intron probably benign
R0967:Gse1 UTSW 8 120570855 intron probably benign
R1395:Gse1 UTSW 8 120574999 intron probably benign
R1480:Gse1 UTSW 8 120572394 intron probably benign
R1532:Gse1 UTSW 8 120568210 intron probably benign
R1649:Gse1 UTSW 8 120578515 intron probably benign
R1728:Gse1 UTSW 8 120568253 intron probably benign
R1742:Gse1 UTSW 8 120566950 missense probably damaging 1.00
R1784:Gse1 UTSW 8 120568253 intron probably benign
R2081:Gse1 UTSW 8 120566480 missense probably damaging 1.00
R2110:Gse1 UTSW 8 120566980 missense probably damaging 1.00
R2974:Gse1 UTSW 8 120570897 intron probably benign
R3615:Gse1 UTSW 8 120572742 intron probably benign
R3616:Gse1 UTSW 8 120572742 intron probably benign
R3857:Gse1 UTSW 8 120571133 intron probably benign
R4494:Gse1 UTSW 8 120570814 intron probably benign
R4857:Gse1 UTSW 8 120572757 intron probably benign
R4911:Gse1 UTSW 8 120568466 intron probably benign
R5640:Gse1 UTSW 8 120562677 missense possibly damaging 0.65
R5782:Gse1 UTSW 8 120566521 missense probably damaging 1.00
R5980:Gse1 UTSW 8 120229637 intron probably benign
R6090:Gse1 UTSW 8 120571169 intron probably benign
R6156:Gse1 UTSW 8 120489127 missense possibly damaging 0.95
R6191:Gse1 UTSW 8 120553803 critical splice donor site probably null
R6270:Gse1 UTSW 8 120569163 intron probably benign
R6502:Gse1 UTSW 8 120553689 unclassified probably null
R6573:Gse1 UTSW 8 120567797 missense probably damaging 1.00
R6885:Gse1 UTSW 8 120229482 intron probably benign
R6901:Gse1 UTSW 8 120229822 intron probably benign
R6959:Gse1 UTSW 8 120570971 intron probably benign
R7023:Gse1 UTSW 8 120230648 intron probably benign
R7210:Gse1 UTSW 8 120230702 missense unknown
R7263:Gse1 UTSW 8 120574171 missense unknown
R7449:Gse1 UTSW 8 120229711 missense unknown
R7602:Gse1 UTSW 8 120569304 missense unknown
R7627:Gse1 UTSW 8 120572777 missense unknown
R7635:Gse1 UTSW 8 120572895 missense unknown
R7689:Gse1 UTSW 8 120568478 missense unknown
X0026:Gse1 UTSW 8 120568163 nonsense probably null
Z1177:Gse1 UTSW 8 120229852 missense unknown
Predicted Primers PCR Primer
(F):5'- AGACAGTGGACATGCTCTTTG -3'
(R):5'- AGCTTACCTCTCTGCACTGAG -3'

Sequencing Primer
(F):5'- GCTCTTTGCATGCAGTCTCTG -3'
(R):5'- TCTGCACTGAGGCTGGACATC -3'
Posted On2017-12-01