Incidental Mutation 'R4206:Ubxn2b'
ID 500501
Institutional Source Beutler Lab
Gene Symbol Ubxn2b
Ensembl Gene ENSMUSG00000028243
Gene Name UBX domain protein 2B
Synonyms
MMRRC Submission 041035-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.355) question?
Stock # R4206 (G1)
Quality Score 222
Status Not validated
Chromosome 4
Chromosomal Location 6191098-6221688 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 6204565 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 142 (V142A)
Ref Sequence ENSEMBL: ENSMUSP00000029907 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029907]
AlphaFold Q0KL01
Predicted Effect probably damaging
Transcript: ENSMUST00000029907
AA Change: V142A

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000029907
Gene: ENSMUSG00000028243
AA Change: V142A

DomainStartEndE-ValueType
low complexity region 8 25 N/A INTRINSIC
SEP 138 232 3.5e-39 SMART
UBX 251 330 1.05e-8 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik T C 2: 151,473,515 K81R probably benign Het
Acacb T C 5: 114,213,651 F1150L probably benign Het
Acat3 A G 17: 12,927,386 Y237H possibly damaging Het
Arfgap3 T C 15: 83,322,668 T240A probably benign Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Cabin1 T C 10: 75,754,841 S23G possibly damaging Het
Clasp1 A G 1: 118,578,906 N949S probably damaging Het
Csrp1 T G 1: 135,745,327 C61G probably damaging Het
Dgka A T 10: 128,721,195 L637Q probably damaging Het
Dst G A 1: 34,212,247 R1801H probably damaging Het
Edil3 T C 13: 89,180,278 S284P probably damaging Het
Eif2d A G 1: 131,154,363 Y64C probably damaging Het
Ell2 A G 13: 75,761,948 D139G probably damaging Het
Fam187a A G 11: 102,886,212 R281G probably damaging Het
Gin1 A G 1: 97,792,420 D380G possibly damaging Het
Gpr149 T G 3: 62,604,503 D25A possibly damaging Het
Gyg A G 3: 20,152,737 S90P probably benign Het
Hpx C T 7: 105,595,147 M190I probably null Het
Irf2bpl C T 12: 86,883,036 V288I probably benign Het
Lyst A G 13: 13,635,989 H748R probably benign Het
Mmrn1 G A 6: 60,958,180 G220D probably damaging Het
Mpdz A T 4: 81,381,762 M333K probably benign Het
Muc5ac C T 7: 141,817,110 S2556F possibly damaging Het
Nfix CAAAAA CAAAA 8: 84,716,247 probably null Het
Ntsr1 A G 2: 180,500,752 D112G probably damaging Het
Olfr1410 A C 1: 92,608,595 T253P possibly damaging Het
Olfr657 T A 7: 104,636,149 N158K possibly damaging Het
Olfr8 T C 10: 78,955,283 F26S probably benign Het
Parg A G 14: 32,254,536 K178R probably benign Het
Pde8b C A 13: 95,222,545 C90F probably benign Het
Pld1 G A 3: 28,120,783 V857I probably benign Het
Rad54l2 A C 9: 106,717,795 V321G probably damaging Het
Rcn2 A G 9: 56,045,207 Y112C possibly damaging Het
Rnf123 A T 9: 108,063,963 D639E probably benign Het
Rufy2 C T 10: 63,004,772 Q441* probably null Het
Scgb2b12 T C 7: 32,326,638 Y43C probably damaging Het
Scrn3 T A 2: 73,319,501 probably null Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slc22a8 T C 19: 8,608,233 S321P probably benign Het
Tex11 C A X: 100,933,415 A487S possibly damaging Het
Tex2 A G 11: 106,567,572 probably benign Het
Tmem2 G T 19: 21,842,115 R1090L probably damaging Het
Trip13 A G 13: 73,932,890 I119T probably benign Het
Tsku C T 7: 98,352,998 R42H probably damaging Het
Ttn A G 2: 76,772,567 I16691T possibly damaging Het
Tyr A G 7: 87,429,068 L528P possibly damaging Het
Uggt2 C T 14: 119,049,262 D221N probably damaging Het
Wnt4 A G 4: 137,296,343 K207R possibly damaging Het
Zfp608 T C 18: 54,988,195 R107G probably damaging Het
Other mutations in Ubxn2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01912:Ubxn2b APN 4 6203767 splice site probably null
IGL02096:Ubxn2b APN 4 6214749 missense probably damaging 1.00
IGL02272:Ubxn2b APN 4 6216071 missense probably damaging 1.00
R0081:Ubxn2b UTSW 4 6203875 splice site probably benign
R0482:Ubxn2b UTSW 4 6196404 splice site probably null
R1903:Ubxn2b UTSW 4 6208889 missense possibly damaging 0.82
R5071:Ubxn2b UTSW 4 6214746 missense probably damaging 1.00
R7622:Ubxn2b UTSW 4 6214692 missense probably damaging 0.98
R8034:Ubxn2b UTSW 4 6191167 missense probably benign 0.06
R8836:Ubxn2b UTSW 4 6216061 missense probably damaging 1.00
R9156:Ubxn2b UTSW 4 6214646 missense probably damaging 1.00
R9413:Ubxn2b UTSW 4 6204607 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGGCCTTCGATATTTGCAG -3'
(R):5'- GAGAGAAGCTATTTTGTCCAACTG -3'

Sequencing Primer
(F):5'- GCAGCTATTATCAGAGCTTTAAGC -3'
(R):5'- CCTATTTGGCGAATTCTCAGCAAGTG -3'
Posted On 2017-12-01