Incidental Mutation 'R4132:Ankrd29'
ID500507
Institutional Source Beutler Lab
Gene Symbol Ankrd29
Ensembl Gene ENSMUSG00000057766
Gene Nameankyrin repeat domain 29
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.278) question?
Stock #R4132 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location12252362-12305720 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 12254700 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 275 (A275V)
Ref Sequence ENSEMBL: ENSMUSP00000114028 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000118525] [ENSMUST00000122408]
Predicted Effect possibly damaging
Transcript: ENSMUST00000118525
AA Change: A275V

PolyPhen 2 Score 0.835 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000114028
Gene: ENSMUSG00000057766
AA Change: A275V

DomainStartEndE-ValueType
ANK 11 41 3.04e0 SMART
ANK 45 74 9.93e-5 SMART
ANK 78 107 1.09e-1 SMART
ANK 111 140 1.2e-3 SMART
ANK 144 173 3.76e-5 SMART
ANK 177 206 1.02e-1 SMART
ANK 210 239 1.52e0 SMART
ANK 242 271 3.01e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000122408
AA Change: A242V

PolyPhen 2 Score 0.785 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000112888
Gene: ENSMUSG00000057766
AA Change: A242V

DomainStartEndE-ValueType
ANK 11 41 3.04e0 SMART
ANK 45 74 9.93e-5 SMART
ANK 78 107 1.09e-1 SMART
ANK 111 140 1.2e-3 SMART
ANK 144 173 3.76e-5 SMART
ANK 177 206 1.02e-1 SMART
ANK 210 239 1.52e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137948
Meta Mutation Damage Score 0.0721 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankmy1 T C 1: 92,885,100 M496V probably benign Het
Cmklr1 C A 5: 113,614,484 R152L probably damaging Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Gm1527 A T 3: 28,920,630 I531L probably benign Het
Grm7 G T 6: 110,646,348 V161F probably damaging Het
Heca A G 10: 17,902,239 S537P probably damaging Het
Icam5 T C 9: 21,036,657 I617T probably benign Het
Itgb2l A G 16: 96,437,389 L70P probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Klhdc4 C T 8: 121,798,065 G375R possibly damaging Het
Myo5c G A 9: 75,252,568 V293I probably benign Het
Ncbp1 C T 4: 46,169,241 R672* probably null Het
Pcdhga2 T C 18: 37,670,054 I317T possibly damaging Het
Safb C A 17: 56,600,848 probably benign Het
Tspan5 C T 3: 138,896,867 R106* probably null Het
Ubap2l A G 3: 90,009,184 Y908H probably damaging Het
Uspl1 A G 5: 149,204,349 N372S probably damaging Het
Vmn1r210 T C 13: 22,827,649 I156V probably benign Het
Zbtb8os A G 4: 129,336,113 Y24C probably damaging Het
Other mutations in Ankrd29
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02806:Ankrd29 APN 18 12275738 missense probably benign 0.00
IGL02956:Ankrd29 APN 18 12260936 missense probably damaging 1.00
R0456:Ankrd29 UTSW 18 12295979 missense probably damaging 1.00
R2879:Ankrd29 UTSW 18 12254700 missense possibly damaging 0.83
R3693:Ankrd29 UTSW 18 12254700 missense possibly damaging 0.83
R3694:Ankrd29 UTSW 18 12254700 missense possibly damaging 0.83
R3699:Ankrd29 UTSW 18 12254700 missense possibly damaging 0.83
R3700:Ankrd29 UTSW 18 12254700 missense possibly damaging 0.83
R4130:Ankrd29 UTSW 18 12254700 missense possibly damaging 0.83
R4745:Ankrd29 UTSW 18 12254622 missense probably benign 0.00
R4989:Ankrd29 UTSW 18 12262185 missense probably damaging 1.00
R5531:Ankrd29 UTSW 18 12279778 missense probably damaging 1.00
R5985:Ankrd29 UTSW 18 12279775 missense probably damaging 1.00
R6187:Ankrd29 UTSW 18 12279690 nonsense probably null
R6627:Ankrd29 UTSW 18 12262164 missense probably benign 0.02
R6895:Ankrd29 UTSW 18 12260989 missense probably benign 0.36
R7671:Ankrd29 UTSW 18 12260986 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TATAGGGCAGTGTGAGAAGCCC -3'
(R):5'- GAGAACAGCGGGTACTACTTCTC -3'

Sequencing Primer
(F):5'- CCACAGGGCAGACATTCTTTC -3'
(R):5'- GAACAGCGGGTACTACTTCTCATTAG -3'
Posted On2017-12-01