Mutagenetix > Incidental Mutations

Incidental Mutation 'R0543:Nup205'

50051

Institutional Source

Beutler Lab

Gene Symbol

Nup205

Ensembl Gene

ENSMUSG00000038759

Gene Name

nucleoporin 205

Synonyms

3830404O05Rik

MMRRC Submission

038735-MU

Accession Numbers

NCBI RefSeq: NM_027513.1; MGI:2141625

Is this an essential gene?

Probably essential (E-score: 0.962) question?

Stock #

R0543 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

35177421-35247596 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 35198969 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 589 (V589A)

Ref Sequence

ENSEMBL: ENSMUSP00000144126 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043815] [ENSMUST00000170234] [ENSMUST00000201374]

AlphaFold

A0A0J9YUD5

Predicted Effect

probably benign
Transcript: ENSMUST00000043815
AA Change: V536A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000039656
Gene: ENSMUSG00000038759
AA Change: V536A

Domain	Start	End	E-Value	Type
low complexity region	2	13	N/A	INTRINSIC
Pfam:Nup192	14	1684	N/A	PFAM
low complexity region	1995	2005	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000170234

SMART Domains

Protein: ENSMUSP00000130033
Gene: ENSMUSG00000038759

Domain	Start	End	E-Value	Type
Pfam:DUF3414	13	322	9.7e-98	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000201374
AA Change: V589A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000144126
Gene: ENSMUSG00000038759
AA Change: V589A

Domain	Start	End	E-Value	Type
low complexity region	36	50	N/A	INTRINSIC
Pfam:Nup192	67	1737	N/A	PFAM
low complexity region	2048	2058	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000202898

Meta Mutation Damage Score

0.0598

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.5%
20x: 93.3%

Validation Efficiency

99% (69/70)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nucleoporin, which is a subunit of the nuclear pore complex that functions in active transport of proteins, RNAs and ribonucleoprotein particles between the nucleus and cytoplasm. Mutations in this gene are associated with steroid-resistant nephrotic syndrome. [provided by RefSeq, Jul 2016]

Allele List at MGI

All alleles(32) : Targeted(2) Gene trapped(30)

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1500015O10Rik	C	A	1: 43,742,289	N110K	possibly damaging	Het
4930444G20Rik	T	C	10: 22,066,924	S386G	possibly damaging	Het
4932438A13Rik	G	A	3: 36,996,458	S2981N	probably benign	Het
Alox5	T	A	6: 116,454,317		probably null	Het
Apol9b	A	G	15: 77,735,640	N212S	probably damaging	Het
Ash1l	T	A	3: 89,063,778		probably null	Het
Ccdc180	A	T	4: 45,900,041	K200*	probably null	Het
Ccser2	A	T	14: 36,940,192	M345K	probably benign	Het
Cdcp2	A	T	4: 107,097,676		probably null	Het
Clca3a1	T	C	3: 144,748,394		probably benign	Het
Cntn3	G	A	6: 102,269,090		probably benign	Het
Col28a1	T	A	6: 8,075,326		probably benign	Het
Dock2	A	G	11: 34,294,325	F1035S	probably damaging	Het
Dsg1a	A	T	18: 20,340,863	S998C	probably damaging	Het
Enox1	T	C	14: 77,506,959		probably benign	Het
Fgfr3	A	G	5: 33,729,710	M1V	probably null	Het
Fuca2	T	A	10: 13,503,126	Y5N	probably damaging	Het
Git2	G	T	5: 114,745,531	H42Q	probably damaging	Het
Gm7964	G	A	7: 83,756,394		noncoding transcript	Het
Hars2	G	A	18: 36,789,424	E337K	probably damaging	Het
Hells	A	G	19: 38,967,750	R797G	probably benign	Het
Hnf1a	G	A	5: 114,950,744	S571L	probably benign	Het
Hoxa5	T	C	6: 52,204,340	Y4C	probably damaging	Het
Inpp4a	G	A	1: 37,369,492		probably benign	Het
Ints6	T	C	14: 62,696,611	I816V	probably damaging	Het
Itpr1	T	C	6: 108,515,748		probably benign	Het
Kcnt2	C	A	1: 140,609,614	P1037T	probably damaging	Het
Lyg2	T	A	1: 37,911,107	M47L	possibly damaging	Het
Macf1	G	T	4: 123,376,378	A4648D	probably damaging	Het
Mcf2l	T	C	8: 12,996,728		probably null	Het
Mcm9	C	T	10: 53,541,598	R3H	probably damaging	Het
Met	T	A	6: 17,491,970	Y244N	probably damaging	Het
Mettl14	A	T	3: 123,374,762	C210S	possibly damaging	Het
Mrgpra4	T	C	7: 47,981,310	Y181C	probably benign	Het
Mtch2	T	C	2: 90,849,682	V86A	possibly damaging	Het
Mttp	A	T	3: 138,111,696	I446N	possibly damaging	Het
Muc4	T	A	16: 32,756,746	S2207T	unknown	Het
Muc5b	A	G	7: 141,851,785	T944A	unknown	Het
Myo15	A	T	11: 60,479,051	H879L	probably benign	Het
Nkiras2	G	A	11: 100,624,192		probably benign	Het
Nostrin	T	G	2: 69,189,131	*507E	probably null	Het
Olfr1141	C	A	2: 87,753,650	L114F	probably damaging	Het
Olfr1444	G	T	19: 12,861,888	V38F	probably benign	Het
Olfr530	A	G	7: 140,373,394	I72T	probably benign	Het
Oxct2b	T	A	4: 123,116,989	M234K	possibly damaging	Het
Park2	G	A	17: 11,067,179	D20N	probably damaging	Het
Pcdha1	A	T	18: 37,185,068	I945F	probably damaging	Het
Pdzd3	A	C	9: 44,248,934	H324Q	probably damaging	Het
Pik3ca	G	A	3: 32,450,261		probably null	Het
Pkhd1l1	A	G	15: 44,523,491		probably null	Het
Plscr1	A	T	9: 92,258,046		probably null	Het
Psd	T	C	19: 46,319,517	E684G	possibly damaging	Het
Rab11fip3	T	C	17: 25,994,225	E870G	probably damaging	Het
Rpl22l1	C	A	3: 28,807,274	Y103*	probably null	Het
Slc38a4	A	T	15: 97,016,839	N44K	possibly damaging	Het
Slco6c1	T	A	1: 97,127,898	I93F	probably damaging	Het
Ssfa2	T	A	2: 79,644,506	S270T	possibly damaging	Het
Strip1	G	A	3: 107,626,775	T181M	possibly damaging	Het
Stxbp5l	G	A	16: 37,208,096	A535V	probably damaging	Het
Tg	A	T	15: 66,729,597	Q152L	probably benign	Het
Thada	T	C	17: 84,423,163	T1036A	probably damaging	Het
Tnfrsf21	C	T	17: 43,038,213	H239Y	probably benign	Het
Tns1	T	A	1: 73,952,697	T941S	probably benign	Het
Tppp3	T	C	8: 105,468,208	D97G	probably benign	Het
Trp53bp1	C	A	2: 121,251,868	A317S	probably null	Het
Trpm7	T	C	2: 126,848,529	I210V	probably damaging	Het
Ubr1	A	G	2: 120,881,093	L1440P	probably damaging	Het
Utp18	A	T	11: 93,875,835	Y317N	probably damaging	Het
Zdhhc5	T	A	2: 84,692,480		probably benign	Het
Zfp719	A	G	7: 43,589,253		probably null	Het

Other mutations in Nup205

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00484:Nup205	APN	6	35214802	missense	probably damaging	1.00
IGL01086:Nup205	APN	6	35208936	splice site	probably benign
IGL01138:Nup205	APN	6	35208084	nonsense	probably null
IGL01333:Nup205	APN	6	35241063	missense	probably benign
IGL01399:Nup205	APN	6	35219689	missense	possibly damaging	0.80
IGL01466:Nup205	APN	6	35199959	missense	probably benign	0.08
IGL01913:Nup205	APN	6	35227430	missense	probably benign	0.10
IGL02159:Nup205	APN	6	35189178	missense	probably damaging	1.00
IGL02442:Nup205	APN	6	35190068	missense	probably benign	0.01
IGL02447:Nup205	APN	6	35227576	splice site	probably null
IGL02558:Nup205	APN	6	35189924	missense	probably damaging	1.00
IGL03306:Nup205	APN	6	35208169	missense	probably damaging	0.98
IGL03328:Nup205	APN	6	35232414	missense	probably damaging	0.99
Figaro	UTSW	6	35196714	splice site	probably null
Marcellina	UTSW	6	35183969	missense	probably damaging	1.00
Spirit	UTSW	6	35232408	missense	probably damaging	0.98
Susanna	UTSW	6	35208109	missense	possibly damaging	0.94
voyager	UTSW	6	35189885	missense	possibly damaging	0.80
BB007:Nup205	UTSW	6	35194576	missense	probably damaging	0.98
BB017:Nup205	UTSW	6	35194576	missense	probably damaging	0.98
P0012:Nup205	UTSW	6	35196543	missense	possibly damaging	0.90
R0102:Nup205	UTSW	6	35225780	splice site	probably benign
R0102:Nup205	UTSW	6	35225780	splice site	probably benign
R0362:Nup205	UTSW	6	35196714	splice site	probably null
R0374:Nup205	UTSW	6	35208837	missense	probably damaging	1.00
R0415:Nup205	UTSW	6	35214634	splice site	probably benign
R0427:Nup205	UTSW	6	35194463	missense	probably benign	0.01
R0611:Nup205	UTSW	6	35225968	missense	probably null	1.00
R0761:Nup205	UTSW	6	35196428	splice site	probably benign
R0828:Nup205	UTSW	6	35194566	missense	probably benign
R0906:Nup205	UTSW	6	35236892	missense	probably damaging	1.00
R1023:Nup205	UTSW	6	35234706	missense	probably damaging	0.98
R1033:Nup205	UTSW	6	35227442	missense	probably benign
R1375:Nup205	UTSW	6	35200071	splice site	probably benign
R1447:Nup205	UTSW	6	35215185	missense	probably benign	0.00
R1468:Nup205	UTSW	6	35225982	critical splice donor site	probably null
R1468:Nup205	UTSW	6	35225982	critical splice donor site	probably null
R1625:Nup205	UTSW	6	35191943	missense	probably benign	0.31
R1652:Nup205	UTSW	6	35238966	missense	probably benign
R1659:Nup205	UTSW	6	35234788	missense	probably benign	0.02
R1693:Nup205	UTSW	6	35210971	missense	probably benign	0.05
R1769:Nup205	UTSW	6	35205431	missense	probably damaging	1.00
R1839:Nup205	UTSW	6	35219714	missense	probably benign	0.00
R1959:Nup205	UTSW	6	35233366	missense	probably benign	0.16
R2051:Nup205	UTSW	6	35230516	missense	probably benign	0.29
R2267:Nup205	UTSW	6	35241349	missense	possibly damaging	0.67
R2401:Nup205	UTSW	6	35208134	nonsense	probably null
R3697:Nup205	UTSW	6	35188711	missense	probably benign	0.15
R3938:Nup205	UTSW	6	35219742	missense	probably damaging	1.00
R4074:Nup205	UTSW	6	35192040	critical splice donor site	probably null
R4117:Nup205	UTSW	6	35241012	nonsense	probably null
R4364:Nup205	UTSW	6	35192027	missense	probably benign	0.38
R4366:Nup205	UTSW	6	35192027	missense	probably benign	0.38
R4594:Nup205	UTSW	6	35196489	missense	probably benign	0.00
R4706:Nup205	UTSW	6	35202008	missense	probably damaging	1.00
R4787:Nup205	UTSW	6	35202061	missense	probably damaging	1.00
R4849:Nup205	UTSW	6	35230570	missense	possibly damaging	0.90
R4850:Nup205	UTSW	6	35230530	missense	probably benign	0.16
R4943:Nup205	UTSW	6	35224639	missense	probably damaging	1.00
R4966:Nup205	UTSW	6	35243849	missense	probably benign	0.00
R5138:Nup205	UTSW	6	35225866	missense	probably damaging	1.00
R5251:Nup205	UTSW	6	35196482	splice site	probably null
R5444:Nup205	UTSW	6	35189189	missense	probably damaging	0.98
R5760:Nup205	UTSW	6	35247343	missense	probably damaging	1.00
R5762:Nup205	UTSW	6	35227680	missense	probably damaging	1.00
R5762:Nup205	UTSW	6	35230548	missense	probably damaging	0.96
R5941:Nup205	UTSW	6	35232408	missense	probably damaging	0.98
R5969:Nup205	UTSW	6	35177578	unclassified	probably benign
R6003:Nup205	UTSW	6	35212816	missense	probably benign
R6178:Nup205	UTSW	6	35243843	missense	possibly damaging	0.85
R6315:Nup205	UTSW	6	35236869	missense	probably damaging	1.00
R6392:Nup205	UTSW	6	35189885	missense	possibly damaging	0.80
R6710:Nup205	UTSW	6	35247373	missense	probably benign	0.00
R6954:Nup205	UTSW	6	35208109	missense	possibly damaging	0.94
R7022:Nup205	UTSW	6	35243936	missense	probably benign	0.45
R7041:Nup205	UTSW	6	35224535	missense	possibly damaging	0.49
R7052:Nup205	UTSW	6	35215142	missense	possibly damaging	0.81
R7310:Nup205	UTSW	6	35225969	missense	possibly damaging	0.78
R7363:Nup205	UTSW	6	35232573	missense	probably benign	0.28
R7399:Nup205	UTSW	6	35214676	missense	probably damaging	0.99
R7428:Nup205	UTSW	6	35227559	missense	probably damaging	1.00
R7553:Nup205	UTSW	6	35201999	missense	probably damaging	1.00
R7665:Nup205	UTSW	6	35177620	missense	possibly damaging	0.46
R7841:Nup205	UTSW	6	35247437	missense	unknown
R7930:Nup205	UTSW	6	35194576	missense	probably damaging	0.98
R7973:Nup205	UTSW	6	35245339	missense	probably benign
R7976:Nup205	UTSW	6	35198953	missense	probably damaging	1.00
R8073:Nup205	UTSW	6	35202169	critical splice donor site	probably null
R8080:Nup205	UTSW	6	35227376	missense	probably damaging	1.00
R8118:Nup205	UTSW	6	35230516	missense	probably benign	0.29
R8213:Nup205	UTSW	6	35225203	missense	probably benign	0.26
R8237:Nup205	UTSW	6	35227503	missense	possibly damaging	0.89
R8408:Nup205	UTSW	6	35225247	missense	probably damaging	1.00
R8807:Nup205	UTSW	6	35183969	missense	probably damaging	1.00
R8812:Nup205	UTSW	6	35214334	missense	probably damaging	1.00
R9261:Nup205	UTSW	6	35199857	missense	probably benign	0.00
R9403:Nup205	UTSW	6	35199974	missense	probably benign	0.45
Z1177:Nup205	UTSW	6	35177605	missense	unknown
Z1177:Nup205	UTSW	6	35208793	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- TTTAAGGTGGAGATTGTAAACGTGCTGA -3'
(R):5'- CCATCTGCGCTCTTGAAAACTTATGCT -3'

Sequencing Primer
(F):5'- GTTGTAGCTTTTACATATGCAAATCC -3'
(R):5'- CGCTCTTGAAAACTTATGCTTTAGAC -3'

Posted On

2013-06-12