Incidental Mutation 'R0543:Nup205'
ID 50051
Institutional Source Beutler Lab
Gene Symbol Nup205
Ensembl Gene ENSMUSG00000038759
Gene Name nucleoporin 205
Synonyms 3830404O05Rik
MMRRC Submission 038735-MU
Accession Numbers

NCBI RefSeq: NM_027513.1; MGI:2141625

Is this an essential gene? Probably essential (E-score: 0.962) question?
Stock # R0543 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 35177421-35247596 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 35198969 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 589 (V589A)
Ref Sequence ENSEMBL: ENSMUSP00000144126 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043815] [ENSMUST00000170234] [ENSMUST00000201374]
AlphaFold A0A0J9YUD5
Predicted Effect probably benign
Transcript: ENSMUST00000043815
AA Change: V536A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000039656
Gene: ENSMUSG00000038759
AA Change: V536A

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:Nup192 14 1684 N/A PFAM
low complexity region 1995 2005 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170234
SMART Domains Protein: ENSMUSP00000130033
Gene: ENSMUSG00000038759

DomainStartEndE-ValueType
Pfam:DUF3414 13 322 9.7e-98 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000201374
AA Change: V589A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000144126
Gene: ENSMUSG00000038759
AA Change: V589A

DomainStartEndE-ValueType
low complexity region 36 50 N/A INTRINSIC
Pfam:Nup192 67 1737 N/A PFAM
low complexity region 2048 2058 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202898
Meta Mutation Damage Score 0.0598 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.3%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nucleoporin, which is a subunit of the nuclear pore complex that functions in active transport of proteins, RNAs and ribonucleoprotein particles between the nucleus and cytoplasm. Mutations in this gene are associated with steroid-resistant nephrotic syndrome. [provided by RefSeq, Jul 2016]
Allele List at MGI

All alleles(32) : Targeted(2) Gene trapped(30)

Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1500015O10Rik C A 1: 43,742,289 N110K possibly damaging Het
4930444G20Rik T C 10: 22,066,924 S386G possibly damaging Het
4932438A13Rik G A 3: 36,996,458 S2981N probably benign Het
Alox5 T A 6: 116,454,317 probably null Het
Apol9b A G 15: 77,735,640 N212S probably damaging Het
Ash1l T A 3: 89,063,778 probably null Het
Ccdc180 A T 4: 45,900,041 K200* probably null Het
Ccser2 A T 14: 36,940,192 M345K probably benign Het
Cdcp2 A T 4: 107,097,676 probably null Het
Clca3a1 T C 3: 144,748,394 probably benign Het
Cntn3 G A 6: 102,269,090 probably benign Het
Col28a1 T A 6: 8,075,326 probably benign Het
Dock2 A G 11: 34,294,325 F1035S probably damaging Het
Dsg1a A T 18: 20,340,863 S998C probably damaging Het
Enox1 T C 14: 77,506,959 probably benign Het
Fgfr3 A G 5: 33,729,710 M1V probably null Het
Fuca2 T A 10: 13,503,126 Y5N probably damaging Het
Git2 G T 5: 114,745,531 H42Q probably damaging Het
Gm7964 G A 7: 83,756,394 noncoding transcript Het
Hars2 G A 18: 36,789,424 E337K probably damaging Het
Hells A G 19: 38,967,750 R797G probably benign Het
Hnf1a G A 5: 114,950,744 S571L probably benign Het
Hoxa5 T C 6: 52,204,340 Y4C probably damaging Het
Inpp4a G A 1: 37,369,492 probably benign Het
Ints6 T C 14: 62,696,611 I816V probably damaging Het
Itpr1 T C 6: 108,515,748 probably benign Het
Kcnt2 C A 1: 140,609,614 P1037T probably damaging Het
Lyg2 T A 1: 37,911,107 M47L possibly damaging Het
Macf1 G T 4: 123,376,378 A4648D probably damaging Het
Mcf2l T C 8: 12,996,728 probably null Het
Mcm9 C T 10: 53,541,598 R3H probably damaging Het
Met T A 6: 17,491,970 Y244N probably damaging Het
Mettl14 A T 3: 123,374,762 C210S possibly damaging Het
Mrgpra4 T C 7: 47,981,310 Y181C probably benign Het
Mtch2 T C 2: 90,849,682 V86A possibly damaging Het
Mttp A T 3: 138,111,696 I446N possibly damaging Het
Muc4 T A 16: 32,756,746 S2207T unknown Het
Muc5b A G 7: 141,851,785 T944A unknown Het
Myo15 A T 11: 60,479,051 H879L probably benign Het
Nkiras2 G A 11: 100,624,192 probably benign Het
Nostrin T G 2: 69,189,131 *507E probably null Het
Olfr1141 C A 2: 87,753,650 L114F probably damaging Het
Olfr1444 G T 19: 12,861,888 V38F probably benign Het
Olfr530 A G 7: 140,373,394 I72T probably benign Het
Oxct2b T A 4: 123,116,989 M234K possibly damaging Het
Park2 G A 17: 11,067,179 D20N probably damaging Het
Pcdha1 A T 18: 37,185,068 I945F probably damaging Het
Pdzd3 A C 9: 44,248,934 H324Q probably damaging Het
Pik3ca G A 3: 32,450,261 probably null Het
Pkhd1l1 A G 15: 44,523,491 probably null Het
Plscr1 A T 9: 92,258,046 probably null Het
Psd T C 19: 46,319,517 E684G possibly damaging Het
Rab11fip3 T C 17: 25,994,225 E870G probably damaging Het
Rpl22l1 C A 3: 28,807,274 Y103* probably null Het
Slc38a4 A T 15: 97,016,839 N44K possibly damaging Het
Slco6c1 T A 1: 97,127,898 I93F probably damaging Het
Ssfa2 T A 2: 79,644,506 S270T possibly damaging Het
Strip1 G A 3: 107,626,775 T181M possibly damaging Het
Stxbp5l G A 16: 37,208,096 A535V probably damaging Het
Tg A T 15: 66,729,597 Q152L probably benign Het
Thada T C 17: 84,423,163 T1036A probably damaging Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Tns1 T A 1: 73,952,697 T941S probably benign Het
Tppp3 T C 8: 105,468,208 D97G probably benign Het
Trp53bp1 C A 2: 121,251,868 A317S probably null Het
Trpm7 T C 2: 126,848,529 I210V probably damaging Het
Ubr1 A G 2: 120,881,093 L1440P probably damaging Het
Utp18 A T 11: 93,875,835 Y317N probably damaging Het
Zdhhc5 T A 2: 84,692,480 probably benign Het
Zfp719 A G 7: 43,589,253 probably null Het
Other mutations in Nup205
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Nup205 APN 6 35214802 missense probably damaging 1.00
IGL01086:Nup205 APN 6 35208936 splice site probably benign
IGL01138:Nup205 APN 6 35208084 nonsense probably null
IGL01333:Nup205 APN 6 35241063 missense probably benign
IGL01399:Nup205 APN 6 35219689 missense possibly damaging 0.80
IGL01466:Nup205 APN 6 35199959 missense probably benign 0.08
IGL01913:Nup205 APN 6 35227430 missense probably benign 0.10
IGL02159:Nup205 APN 6 35189178 missense probably damaging 1.00
IGL02442:Nup205 APN 6 35190068 missense probably benign 0.01
IGL02447:Nup205 APN 6 35227576 splice site probably null
IGL02558:Nup205 APN 6 35189924 missense probably damaging 1.00
IGL03306:Nup205 APN 6 35208169 missense probably damaging 0.98
IGL03328:Nup205 APN 6 35232414 missense probably damaging 0.99
Figaro UTSW 6 35196714 splice site probably null
Marcellina UTSW 6 35183969 missense probably damaging 1.00
Spirit UTSW 6 35232408 missense probably damaging 0.98
Susanna UTSW 6 35208109 missense possibly damaging 0.94
voyager UTSW 6 35189885 missense possibly damaging 0.80
BB007:Nup205 UTSW 6 35194576 missense probably damaging 0.98
BB017:Nup205 UTSW 6 35194576 missense probably damaging 0.98
P0012:Nup205 UTSW 6 35196543 missense possibly damaging 0.90
R0102:Nup205 UTSW 6 35225780 splice site probably benign
R0102:Nup205 UTSW 6 35225780 splice site probably benign
R0362:Nup205 UTSW 6 35196714 splice site probably null
R0374:Nup205 UTSW 6 35208837 missense probably damaging 1.00
R0415:Nup205 UTSW 6 35214634 splice site probably benign
R0427:Nup205 UTSW 6 35194463 missense probably benign 0.01
R0611:Nup205 UTSW 6 35225968 missense probably null 1.00
R0761:Nup205 UTSW 6 35196428 splice site probably benign
R0828:Nup205 UTSW 6 35194566 missense probably benign
R0906:Nup205 UTSW 6 35236892 missense probably damaging 1.00
R1023:Nup205 UTSW 6 35234706 missense probably damaging 0.98
R1033:Nup205 UTSW 6 35227442 missense probably benign
R1375:Nup205 UTSW 6 35200071 splice site probably benign
R1447:Nup205 UTSW 6 35215185 missense probably benign 0.00
R1468:Nup205 UTSW 6 35225982 critical splice donor site probably null
R1468:Nup205 UTSW 6 35225982 critical splice donor site probably null
R1625:Nup205 UTSW 6 35191943 missense probably benign 0.31
R1652:Nup205 UTSW 6 35238966 missense probably benign
R1659:Nup205 UTSW 6 35234788 missense probably benign 0.02
R1693:Nup205 UTSW 6 35210971 missense probably benign 0.05
R1769:Nup205 UTSW 6 35205431 missense probably damaging 1.00
R1839:Nup205 UTSW 6 35219714 missense probably benign 0.00
R1959:Nup205 UTSW 6 35233366 missense probably benign 0.16
R2051:Nup205 UTSW 6 35230516 missense probably benign 0.29
R2267:Nup205 UTSW 6 35241349 missense possibly damaging 0.67
R2401:Nup205 UTSW 6 35208134 nonsense probably null
R3697:Nup205 UTSW 6 35188711 missense probably benign 0.15
R3938:Nup205 UTSW 6 35219742 missense probably damaging 1.00
R4074:Nup205 UTSW 6 35192040 critical splice donor site probably null
R4117:Nup205 UTSW 6 35241012 nonsense probably null
R4364:Nup205 UTSW 6 35192027 missense probably benign 0.38
R4366:Nup205 UTSW 6 35192027 missense probably benign 0.38
R4594:Nup205 UTSW 6 35196489 missense probably benign 0.00
R4706:Nup205 UTSW 6 35202008 missense probably damaging 1.00
R4787:Nup205 UTSW 6 35202061 missense probably damaging 1.00
R4849:Nup205 UTSW 6 35230570 missense possibly damaging 0.90
R4850:Nup205 UTSW 6 35230530 missense probably benign 0.16
R4943:Nup205 UTSW 6 35224639 missense probably damaging 1.00
R4966:Nup205 UTSW 6 35243849 missense probably benign 0.00
R5138:Nup205 UTSW 6 35225866 missense probably damaging 1.00
R5251:Nup205 UTSW 6 35196482 splice site probably null
R5444:Nup205 UTSW 6 35189189 missense probably damaging 0.98
R5760:Nup205 UTSW 6 35247343 missense probably damaging 1.00
R5762:Nup205 UTSW 6 35227680 missense probably damaging 1.00
R5762:Nup205 UTSW 6 35230548 missense probably damaging 0.96
R5941:Nup205 UTSW 6 35232408 missense probably damaging 0.98
R5969:Nup205 UTSW 6 35177578 unclassified probably benign
R6003:Nup205 UTSW 6 35212816 missense probably benign
R6178:Nup205 UTSW 6 35243843 missense possibly damaging 0.85
R6315:Nup205 UTSW 6 35236869 missense probably damaging 1.00
R6392:Nup205 UTSW 6 35189885 missense possibly damaging 0.80
R6710:Nup205 UTSW 6 35247373 missense probably benign 0.00
R6954:Nup205 UTSW 6 35208109 missense possibly damaging 0.94
R7022:Nup205 UTSW 6 35243936 missense probably benign 0.45
R7041:Nup205 UTSW 6 35224535 missense possibly damaging 0.49
R7052:Nup205 UTSW 6 35215142 missense possibly damaging 0.81
R7310:Nup205 UTSW 6 35225969 missense possibly damaging 0.78
R7363:Nup205 UTSW 6 35232573 missense probably benign 0.28
R7399:Nup205 UTSW 6 35214676 missense probably damaging 0.99
R7428:Nup205 UTSW 6 35227559 missense probably damaging 1.00
R7553:Nup205 UTSW 6 35201999 missense probably damaging 1.00
R7665:Nup205 UTSW 6 35177620 missense possibly damaging 0.46
R7841:Nup205 UTSW 6 35247437 missense unknown
R7930:Nup205 UTSW 6 35194576 missense probably damaging 0.98
R7973:Nup205 UTSW 6 35245339 missense probably benign
R7976:Nup205 UTSW 6 35198953 missense probably damaging 1.00
R8073:Nup205 UTSW 6 35202169 critical splice donor site probably null
R8080:Nup205 UTSW 6 35227376 missense probably damaging 1.00
R8118:Nup205 UTSW 6 35230516 missense probably benign 0.29
R8213:Nup205 UTSW 6 35225203 missense probably benign 0.26
R8237:Nup205 UTSW 6 35227503 missense possibly damaging 0.89
R8408:Nup205 UTSW 6 35225247 missense probably damaging 1.00
R8807:Nup205 UTSW 6 35183969 missense probably damaging 1.00
R8812:Nup205 UTSW 6 35214334 missense probably damaging 1.00
R9261:Nup205 UTSW 6 35199857 missense probably benign 0.00
R9403:Nup205 UTSW 6 35199974 missense probably benign 0.45
Z1177:Nup205 UTSW 6 35177605 missense unknown
Z1177:Nup205 UTSW 6 35208793 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TTTAAGGTGGAGATTGTAAACGTGCTGA -3'
(R):5'- CCATCTGCGCTCTTGAAAACTTATGCT -3'

Sequencing Primer
(F):5'- GTTGTAGCTTTTACATATGCAAATCC -3'
(R):5'- CGCTCTTGAAAACTTATGCTTTAGAC -3'
Posted On 2013-06-12