Incidental Mutation 'R4155:Arl6ip1'
ID500510
Institutional Source Beutler Lab
Gene Symbol Arl6ip1
Ensembl Gene ENSMUSG00000030654
Gene NameADP-ribosylation factor-like 6 interacting protein 1
SynonymsAIP-6, ARMER
MMRRC Submission 040999-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4155 (G1)
Quality Score167
Status Not validated
Chromosome7
Chromosomal Location118118891-118129662 bp(-) (GRCm38)
Type of Mutationcritical splice donor site
DNA Base Change (assembly) AAAATAAATAAATAAATAAATAAATA to AAAATAAATAAATAAATAAATAAATAAATA at 118121899 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000146175 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032888] [ENSMUST00000203154] [ENSMUST00000204005] [ENSMUST00000206491]
Predicted Effect probably benign
Transcript: ENSMUST00000032888
SMART Domains Protein: ENSMUSP00000032888
Gene: ENSMUSG00000030654

DomainStartEndE-ValueType
transmembrane domain 42 61 N/A INTRINSIC
transmembrane domain 66 88 N/A INTRINSIC
transmembrane domain 136 153 N/A INTRINSIC
transmembrane domain 158 180 N/A INTRINSIC
low complexity region 192 203 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000203154
Predicted Effect probably benign
Transcript: ENSMUST00000204005
SMART Domains Protein: ENSMUSP00000145418
Gene: ENSMUSG00000030654

DomainStartEndE-ValueType
low complexity region 8 17 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205182
Predicted Effect probably benign
Transcript: ENSMUST00000206491
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206536
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the ARL6ip family and encodes a transmembrane protein that is predominantly localized to intracytoplasmic membranes. It is highly expressed in early myeloid progenitor cells and thought to be involved in protein transport, membrane trafficking, or cell signaling during hematopoietic maturation. Mutations in this gene are associated with spastic paraplegia 61 (SPG61). Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2015]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410004B18Rik T A 3: 145,938,263 F69I possibly damaging Het
Akt3 A G 1: 177,096,977 I184T possibly damaging Het
Armc2 A G 10: 42,011,867 V40A probably damaging Het
Ash2l A G 8: 25,817,454 Y485H probably damaging Het
Atr T A 9: 95,888,124 C1202* probably null Het
Bcl11b A T 12: 107,917,425 probably null Het
Birc6 C A 17: 74,596,939 S1242R probably benign Het
Blm GCCTCCTCCTCCTCCTCCTCCTCCTCCTCC GCCTCCTCCTCCTCCTCCTCCTCCTCC 7: 80,512,904 probably benign Het
Bsx A G 9: 40,876,336 E102G probably benign Het
Casq2 A T 3: 102,133,102 probably null Het
Ccpg1 C A 9: 73,012,167 Q355K probably benign Het
Copa T G 1: 172,101,425 N251K probably damaging Het
Cst8 C A 2: 148,800,076 A31E possibly damaging Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Ecd A G 14: 20,324,564 S503P probably damaging Het
Fam155a T A 8: 9,233,023 Y342F possibly damaging Het
Fbn2 C A 18: 58,023,287 E2487* probably null Het
Hoxd9 A G 2: 74,699,323 I308V probably benign Het
Ica1l G A 1: 60,013,893 A162V possibly damaging Het
Kcnj15 A T 16: 95,296,307 K263* probably null Het
Mettl4 T C 17: 94,740,575 M213V probably benign Het
Ncan C A 8: 70,110,077 E510D possibly damaging Het
Ndufs4 A T 13: 114,307,854 S129R probably benign Het
Olfr1262 A G 2: 90,002,660 S85G probably benign Het
Olfr305 T A 7: 86,364,062 I92L probably benign Het
Olfr601 T C 7: 103,359,156 T13A probably benign Het
Olfr933 A T 9: 38,976,155 T160S probably damaging Het
P2rx5 A G 11: 73,171,829 T455A probably damaging Het
Pcdh1 T A 18: 38,203,106 T159S probably damaging Het
Poln A G 5: 34,009,649 V755A possibly damaging Het
Pou4f1 C T 14: 104,467,717 S6N possibly damaging Het
Rpap1 C T 2: 119,774,179 R416H probably damaging Het
Samd4 T A 14: 47,052,946 M170K possibly damaging Het
Srgn A G 10: 62,497,834 F55L possibly damaging Het
Tmcc1 C T 6: 116,133,804 G176D probably benign Het
Tmem232 A T 17: 65,436,333 M321K probably damaging Het
Tnfsf11 A G 14: 78,299,869 M118T probably benign Het
Tns1 T A 1: 73,914,631 N1848Y probably damaging Het
Ttc27 T G 17: 74,840,460 I669S probably benign Het
Uaca A G 9: 60,871,753 S1141G probably benign Het
Usp34 T A 11: 23,417,676 V1671E probably damaging Het
Wdr64 T A 1: 175,769,606 L73H probably benign Het
Zfp410 G A 12: 84,327,432 R181H probably damaging Het
Other mutations in Arl6ip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1412:Arl6ip1 UTSW 7 118120368 missense possibly damaging 0.96
R4156:Arl6ip1 UTSW 7 118121899 critical splice donor site probably benign
R4157:Arl6ip1 UTSW 7 118121899 critical splice donor site probably benign
R4201:Arl6ip1 UTSW 7 118121899 critical splice donor site probably benign
R4206:Arl6ip1 UTSW 7 118121899 critical splice donor site probably benign
R4271:Arl6ip1 UTSW 7 118121899 critical splice donor site probably benign
R4276:Arl6ip1 UTSW 7 118121899 critical splice donor site probably benign
R4277:Arl6ip1 UTSW 7 118121899 critical splice donor site probably benign
R4278:Arl6ip1 UTSW 7 118121899 critical splice donor site probably benign
R4280:Arl6ip1 UTSW 7 118121899 critical splice donor site probably benign
R4281:Arl6ip1 UTSW 7 118121899 critical splice donor site probably benign
R4283:Arl6ip1 UTSW 7 118121899 critical splice donor site probably benign
R4330:Arl6ip1 UTSW 7 118121899 critical splice donor site probably benign
R4502:Arl6ip1 UTSW 7 118121899 critical splice donor site probably benign
R4503:Arl6ip1 UTSW 7 118121899 critical splice donor site probably benign
R4547:Arl6ip1 UTSW 7 118121899 critical splice donor site probably benign
R4548:Arl6ip1 UTSW 7 118121899 critical splice donor site probably benign
R4580:Arl6ip1 UTSW 7 118121899 critical splice donor site probably benign
R4604:Arl6ip1 UTSW 7 118121899 critical splice donor site probably benign
R4774:Arl6ip1 UTSW 7 118121985 missense probably damaging 1.00
R4804:Arl6ip1 UTSW 7 118129552 splice site probably null
R4805:Arl6ip1 UTSW 7 118121899 critical splice donor site probably benign
R4807:Arl6ip1 UTSW 7 118121899 critical splice donor site probably benign
R6211:Arl6ip1 UTSW 7 118127250 missense probably benign 0.44
R6651:Arl6ip1 UTSW 7 118129485 missense probably benign 0.00
R7548:Arl6ip1 UTSW 7 118126510 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTACCTTCCCAGTTAGCAC -3'
(R):5'- GGAGGTCAAGAGTCTTAGCTG -3'

Sequencing Primer
(F):5'- CCAGTTAGCACTTCCCACC -3'
(R):5'- GTGGAAACGCCTCTTTTC -3'
Posted On2017-12-01