Incidental Mutation 'R4284:Tmem161a'
ID500513
Institutional Source Beutler Lab
Gene Symbol Tmem161a
Ensembl Gene ENSMUSG00000002342
Gene Nametransmembrane protein 161A
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.184) question?
Stock #R4284 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location70172356-70183681 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to G at 70177426 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000138499 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002413] [ENSMUST00000147656] [ENSMUST00000149105] [ENSMUST00000182365] [ENSMUST00000182715] [ENSMUST00000182980]
Predicted Effect probably benign
Transcript: ENSMUST00000002413
SMART Domains Protein: ENSMUSP00000002413
Gene: ENSMUSG00000002342

DomainStartEndE-ValueType
Pfam:Tmemb_161AB 2 478 6.8e-182 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123923
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125755
Predicted Effect probably benign
Transcript: ENSMUST00000125906
SMART Domains Protein: ENSMUSP00000137791
Gene: ENSMUSG00000002342

DomainStartEndE-ValueType
Pfam:Tmemb_161AB 1 119 8.7e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126268
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133084
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133339
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143543
Predicted Effect probably benign
Transcript: ENSMUST00000147656
SMART Domains Protein: ENSMUSP00000138017
Gene: ENSMUSG00000002342

DomainStartEndE-ValueType
Pfam:Tmemb_161AB 2 270 4.6e-122 PFAM
low complexity region 283 296 N/A INTRINSIC
low complexity region 309 320 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000149105
SMART Domains Protein: ENSMUSP00000123084
Gene: ENSMUSG00000002342

DomainStartEndE-ValueType
Pfam:Tmemb_161AB 1 95 5.1e-41 PFAM
Pfam:Tmemb_161AB 93 454 9.5e-148 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182365
SMART Domains Protein: ENSMUSP00000138641
Gene: ENSMUSG00000002342

DomainStartEndE-ValueType
Pfam:Tmemb_161AB 2 98 3.7e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182715
SMART Domains Protein: ENSMUSP00000138432
Gene: ENSMUSG00000002342

DomainStartEndE-ValueType
Pfam:Tmemb_161AB 2 45 3.3e-15 PFAM
low complexity region 152 165 N/A INTRINSIC
low complexity region 178 189 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182942
Predicted Effect probably benign
Transcript: ENSMUST00000182980
SMART Domains Protein: ENSMUSP00000138499
Gene: ENSMUSG00000002342

DomainStartEndE-ValueType
Pfam:Tmemb_161AB 1 328 4.6e-133 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik A G 1: 105,721,287 D717G probably damaging Het
Agl G A 3: 116,752,178 S1323L possibly damaging Het
Capg T C 6: 72,561,099 Y323H probably damaging Het
Cdh23 T C 10: 60,303,493 T3314A possibly damaging Het
Cilp A T 9: 65,278,278 T552S probably damaging Het
Cox16 T C 12: 81,474,519 probably null Het
Ctu2 G A 8: 122,478,239 V88I probably benign Het
Elfn1 A T 5: 139,972,314 K358* probably null Het
Enpp6 T C 8: 47,069,015 F328S probably damaging Het
Galnt12 T C 4: 47,104,231 L163P probably damaging Het
Gcfc2 G A 6: 81,941,391 R354H probably damaging Het
Hcn1 ACAGCAGCAGCAGCAGCAGCAGCAACAGCAACAACAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC ACAGCAGCAGCAGCAGCAGCAACAGCAACAACAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC 13: 117,975,733 probably benign Het
Ikbke C T 1: 131,275,778 probably null Het
Il1rn T C 2: 24,349,545 L151P probably damaging Het
Jmjd6 T C 11: 116,842,708 R48G probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lilra6 T C 7: 3,908,804 H285R possibly damaging Het
Lrp2 G A 2: 69,480,094 R2712C possibly damaging Het
Magi3 C A 3: 104,015,868 G1178* probably null Het
Memo1 T C 17: 74,255,298 probably null Het
Mug2 T A 6: 122,063,673 D727E probably benign Het
Sema3c A G 5: 17,678,347 T318A probably benign Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slc20a2 G A 8: 22,561,349 R466Q probably benign Het
Slc25a51 C T 4: 45,399,768 V141M probably benign Het
Sox5 T C 6: 143,835,329 K570E probably damaging Het
Ssbp1 T G 6: 40,477,917 probably null Het
Sult5a1 A G 8: 123,149,230 S116P probably damaging Het
Tktl2 T A 8: 66,513,156 D455E probably damaging Het
Tm9sf1 T C 14: 55,641,323 Y204C probably damaging Het
Ttn T A 2: 76,792,867 K13663* probably null Het
Unc5c T C 3: 141,714,674 I52T probably damaging Het
Other mutations in Tmem161a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02049:Tmem161a APN 8 70178974 missense probably damaging 1.00
IGL02425:Tmem161a APN 8 70176927 critical splice donor site probably null
IGL02597:Tmem161a APN 8 70182043 missense probably damaging 1.00
IGL02622:Tmem161a APN 8 70181237 nonsense probably null
PIT4431001:Tmem161a UTSW 8 70182024 missense probably damaging 0.99
R0498:Tmem161a UTSW 8 70180973 missense probably benign 0.00
R1881:Tmem161a UTSW 8 70180785 missense probably null 1.00
R1970:Tmem161a UTSW 8 70176909 missense probably damaging 1.00
R1971:Tmem161a UTSW 8 70176909 missense probably damaging 1.00
R2027:Tmem161a UTSW 8 70177520 missense probably damaging 1.00
R2384:Tmem161a UTSW 8 70177554 missense probably benign 0.00
R2870:Tmem161a UTSW 8 70178915 intron probably benign
R2872:Tmem161a UTSW 8 70178915 intron probably benign
R4271:Tmem161a UTSW 8 70181512 missense probably damaging 1.00
R4576:Tmem161a UTSW 8 70182063 unclassified probably null
R4677:Tmem161a UTSW 8 70180947 unclassified probably null
R6322:Tmem161a UTSW 8 70182114 missense probably damaging 1.00
R6823:Tmem161a UTSW 8 70181199 missense probably damaging 1.00
R7452:Tmem161a UTSW 8 70177488 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGGGCAAATGGTCTTCATGAC -3'
(R):5'- TCACCCACATGCTAAGTGCC -3'

Sequencing Primer
(F):5'- GTCTTCATGACGAGAAGCCATTGTC -3'
(R):5'- CCACATGCTAAGTGCCAGAGAAG -3'
Posted On2017-12-01