Incidental Mutation 'R4273:Tango2'
ID 500520
Institutional Source Beutler Lab
Gene Symbol Tango2
Ensembl Gene ENSMUSG00000013539
Gene Name transport and golgi organization 2
Synonyms D16H22S680E, T10
MMRRC Submission 041645-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4273 (G1)
Quality Score 225
Status Not validated
Chromosome 16
Chromosomal Location 18118689-18165962 bp(-) (GRCm39)
Type of Mutation unclassified
DNA Base Change (assembly) T to C at 18120654 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000156240 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115628] [ENSMUST00000128580] [ENSMUST00000231372] [ENSMUST00000231543] [ENSMUST00000231605] [ENSMUST00000232588]
AlphaFold no structure available at present
Predicted Effect silent
Transcript: ENSMUST00000115628
SMART Domains Protein: ENSMUSP00000111291
Gene: ENSMUSG00000013539

DomainStartEndE-ValueType
Pfam:TANGO2 1 259 4.6e-77 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128580
SMART Domains Protein: ENSMUSP00000121582
Gene: ENSMUSG00000013539

DomainStartEndE-ValueType
Pfam:NRDE 1 151 4.5e-58 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145758
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231308
Predicted Effect probably benign
Transcript: ENSMUST00000231372
Predicted Effect probably benign
Transcript: ENSMUST00000231543
Predicted Effect silent
Transcript: ENSMUST00000231605
Predicted Effect probably benign
Transcript: ENSMUST00000232588
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the transport and Golgi organization family, whose members are predicted to play roles in secretory protein loading in the endoplasmic reticulum. Depletion of this gene in Drosophila S2 cells causes fusion of the Golgi with the ER. In mouse tissue culture cells, this protein co-localizes with a mitochondrially targeted mCherry protein and displays very low levels of co-localization with Golgi and peroxisomes. Allelic variants of this gene are associated with rhabdomyolysis, metabolic crises with encephalopathy, and cardiac arrhythmia. [provided by RefSeq, Apr 2016]
Allele List at MGI

All alleles(8) : Gene trapped(8)

Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acer2 T A 4: 86,792,835 (GRCm39) probably null Het
Adgrf2 T A 17: 43,021,013 (GRCm39) T604S probably damaging Het
Akap8l T A 17: 32,540,905 (GRCm39) K533* probably null Het
Appbp2 T C 11: 85,125,502 (GRCm39) Y45C probably damaging Het
Arap2 T C 5: 62,828,322 (GRCm39) I950V possibly damaging Het
Arhgap31 T C 16: 38,422,697 (GRCm39) E1123G possibly damaging Het
Atp2c1 G T 9: 105,312,339 (GRCm39) N493K probably benign Het
Bcr T C 10: 74,960,943 (GRCm39) I458T probably damaging Het
Brd4 G A 17: 32,433,756 (GRCm39) T468I probably benign Het
Cdh23 T A 10: 60,146,940 (GRCm39) D2774V possibly damaging Het
Cfdp1 T C 8: 112,495,417 (GRCm39) Y267C probably damaging Het
Chd6 C A 2: 160,803,211 (GRCm39) A2156S probably benign Het
Dazap2 C A 15: 100,515,971 (GRCm39) P100T probably damaging Het
Disp1 T A 1: 182,869,208 (GRCm39) I1071F possibly damaging Het
Dlgap1 T A 17: 71,073,038 (GRCm39) S686T probably benign Het
Dst C T 1: 34,231,421 (GRCm39) R3183C possibly damaging Het
Enpp4 T C 17: 44,412,698 (GRCm39) N279D probably benign Het
Exoc3l T C 8: 106,016,593 (GRCm39) *740W probably null Het
Exoc5 A T 14: 49,252,937 (GRCm39) C625* probably null Het
Fam98b A T 2: 117,090,712 (GRCm39) N137Y possibly damaging Het
Fat4 T A 3: 38,945,776 (GRCm39) D1556E probably damaging Het
Fcer2a C A 8: 3,732,848 (GRCm39) V319L possibly damaging Het
Fer1l6 T C 15: 58,499,371 (GRCm39) V1247A probably benign Het
Fmo4 A G 1: 162,632,748 (GRCm39) V201A probably damaging Het
Fras1 G A 5: 96,762,763 (GRCm39) G755D probably benign Het
Grid2 T C 6: 63,886,029 (GRCm39) Y142H probably damaging Het
Hspg2 C T 4: 137,246,251 (GRCm39) R1010C probably damaging Het
Ibtk T C 9: 85,608,784 (GRCm39) Q376R probably damaging Het
Impdh2 T C 9: 108,442,155 (GRCm39) M414T probably damaging Het
Itm2c A G 1: 85,834,750 (GRCm39) T160A probably damaging Het
Kcna2 T A 3: 107,012,509 (GRCm39) D363E probably benign Het
Lama2 C T 10: 27,223,050 (GRCm39) C412Y probably damaging Het
Lims2 C G 18: 32,089,390 (GRCm39) T151S probably benign Het
Mier1 T C 4: 103,019,628 (GRCm39) S423P possibly damaging Het
Mrgpra3 A T 7: 47,239,180 (GRCm39) W249R probably benign Het
Mtor A G 4: 148,634,609 (GRCm39) H2410R probably benign Het
Mvp C T 7: 126,588,875 (GRCm39) A631T probably benign Het
Nepro T C 16: 44,556,192 (GRCm39) V450A possibly damaging Het
Ngrn T C 7: 79,914,269 (GRCm39) V140A probably damaging Het
Nobox T C 6: 43,282,942 (GRCm39) E231G probably benign Het
Or10al7 A T 17: 38,366,163 (GRCm39) I98N probably damaging Het
P3h2 T A 16: 25,923,971 (GRCm39) I155F probably benign Het
Pcdha3 C T 18: 37,081,144 (GRCm39) R629C probably damaging Het
Pramel24 A T 4: 143,453,416 (GRCm39) K175* probably null Het
Riok3 AGAAGCGG AG 18: 12,268,998 (GRCm39) probably benign Het
Rttn T C 18: 89,110,020 (GRCm39) I1675T probably benign Het
Sall2 C A 14: 52,551,260 (GRCm39) R643L probably damaging Het
Slc35f4 G T 14: 49,541,758 (GRCm39) T182N possibly damaging Het
Slc52a3 T A 2: 151,847,660 (GRCm39) I256N possibly damaging Het
Sox9 T C 11: 112,675,980 (GRCm39) S390P possibly damaging Het
Tas1r1 T C 4: 152,116,614 (GRCm39) E340G possibly damaging Het
Tek G A 4: 94,718,207 (GRCm39) G524R probably damaging Het
Tmem260 A T 14: 48,742,761 (GRCm39) Y532F probably benign Het
Tsks C A 7: 44,607,353 (GRCm39) L559I probably damaging Het
Unc79 C A 12: 103,088,612 (GRCm39) L1702I probably damaging Het
Vmn1r14 T A 6: 57,211,133 (GRCm39) I237N probably damaging Het
Vmn2r17 G A 5: 109,600,832 (GRCm39) C710Y probably benign Het
Zfp119b G T 17: 56,245,926 (GRCm39) T420K possibly damaging Het
Zfp202 C T 9: 40,118,790 (GRCm39) R68* probably null Het
Zfp229 T A 17: 21,965,802 (GRCm39) S677R probably benign Het
Zfp462 C T 4: 55,008,411 (GRCm39) H126Y probably benign Het
Zfp52 C A 17: 21,780,459 (GRCm39) Y102* probably null Het
Zfp616 T A 11: 73,974,526 (GRCm39) M265K probably benign Het
Zfyve9 A T 4: 108,538,173 (GRCm39) I1031N probably damaging Het
Zmynd11 T C 13: 9,747,726 (GRCm39) Y203C probably damaging Het
Other mutations in Tango2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02458:Tango2 APN 16 18,128,731 (GRCm39) critical splice donor site probably null
IGL02751:Tango2 APN 16 18,125,857 (GRCm39) missense probably benign 0.01
D4186:Tango2 UTSW 16 18,130,530 (GRCm39) missense possibly damaging 0.83
I0000:Tango2 UTSW 16 18,130,530 (GRCm39) missense possibly damaging 0.83
R2179:Tango2 UTSW 16 18,128,762 (GRCm39) missense probably damaging 1.00
R4536:Tango2 UTSW 16 18,142,219 (GRCm39) critical splice donor site probably null
R4576:Tango2 UTSW 16 18,119,392 (GRCm39) missense probably damaging 1.00
R4860:Tango2 UTSW 16 18,128,765 (GRCm39) synonymous silent
R5988:Tango2 UTSW 16 18,120,554 (GRCm39) missense probably damaging 1.00
R6392:Tango2 UTSW 16 18,119,403 (GRCm39) missense probably damaging 0.99
R7596:Tango2 UTSW 16 18,120,574 (GRCm39) missense probably damaging 1.00
R8967:Tango2 UTSW 16 18,165,763 (GRCm39) start gained probably benign
X0062:Tango2 UTSW 16 18,120,579 (GRCm39) splice site probably null
Predicted Primers PCR Primer
(F):5'- CCATGGCCAGCTGTATTGTG -3'
(R):5'- TAGAGAGTGTATGTGCCATCTG -3'

Sequencing Primer
(F):5'- CCAGCTGTATTGTGGGGGATAC -3'
(R):5'- ATGTGCCATCTGGATGCC -3'
Posted On 2017-12-01