Incidental Mutation 'R4304:Stk10'
ID500525
Institutional Source Beutler Lab
Gene Symbol Stk10
Ensembl Gene ENSMUSG00000020272
Gene Nameserine/threonine kinase 10
SynonymsGek1, Lok
MMRRC Submission 040865-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #R4304 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location32533305-32624587 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 32610634 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 663 (V663A)
Ref Sequence ENSEMBL: ENSMUSP00000099885 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102821]
Predicted Effect probably damaging
Transcript: ENSMUST00000102821
AA Change: V663A

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000099885
Gene: ENSMUSG00000020272
AA Change: V663A

DomainStartEndE-ValueType
S_TKc 36 294 8.66e-92 SMART
low complexity region 316 334 N/A INTRINSIC
low complexity region 544 577 N/A INTRINSIC
Pfam:PKK 586 724 1.9e-41 PFAM
Pfam:PKK 754 894 2.2e-37 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the Ste20 family of serine/threonine protein kinases, and is similar to several known polo-like kinase kinases. Mice deficient for this gene product are viable, but exhibit altered integrin-mediated lymphocyte adhesion characteristics. The orthologous gene product in humans can associate with and phosphorylate polo-like kinase 1, and overexpression of a kinase-dead version of the protein interferes with normal cell cycle progression. [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted disruption of this gene results in enhanced cell adhesion in mitogen-stimulated T cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik C T 6: 149,326,238 Q261* probably null Het
Adam32 A T 8: 24,901,529 M323K probably damaging Het
Arhgap42 A G 9: 9,006,488 S636P probably benign Het
Arhgef5 C T 6: 43,279,498 A1180V probably damaging Het
Cep152 G A 2: 125,563,723 Q1630* probably null Het
Cfap157 G A 2: 32,779,042 R350W probably damaging Het
Csgalnact1 A T 8: 68,372,642 V400D possibly damaging Het
Fig4 T A 10: 41,256,427 D461V probably benign Het
Frmd4a C T 2: 4,333,078 R32C probably benign Het
Gcfc2 G A 6: 81,943,007 R397Q probably damaging Het
Gm20939 A C 17: 94,877,281 Q452H probably benign Het
Gm5592 A T 7: 41,286,262 M63L probably benign Het
Gm7173 C G X: 79,498,029 K469N probably damaging Het
H2-M3 T C 17: 37,272,404 M252T probably benign Het
Lsm14a C A 7: 34,357,433 probably null Het
Map4k4 T C 1: 39,973,972 Y76H possibly damaging Het
Npc1 C T 18: 12,210,527 A470T possibly damaging Het
Oit1 G A 14: 8,349,324 P209S probably damaging Het
Olfr1240 A T 2: 89,440,198 V27D probably damaging Het
Prr27 A G 5: 87,842,907 H126R probably benign Het
Rptn C A 3: 93,396,931 H524N probably benign Het
Slc4a11 A T 2: 130,688,138 M240K probably benign Het
Smg1 T C 7: 118,139,518 I3503V probably benign Het
Snx13 A G 12: 35,122,942 K625E probably benign Het
Tex11 C A X: 100,933,415 A487S possibly damaging Het
Tpp1 T A 7: 105,750,309 D84V possibly damaging Het
Vmn1r238 T A 18: 3,123,040 R125* probably null Het
Vmn2r12 A G 5: 109,086,006 L780P probably damaging Het
Wfdc15b A C 2: 164,215,468 M1R probably null Het
Wnk2 C T 13: 49,090,837 D508N probably damaging Het
Other mutations in Stk10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01105:Stk10 APN 11 32577740 missense probably benign 0.33
IGL01285:Stk10 APN 11 32610653 missense possibly damaging 0.91
IGL01983:Stk10 APN 11 32589460 missense probably benign 0.05
IGL03177:Stk10 APN 11 32614592 missense probably damaging 1.00
IGL03183:Stk10 APN 11 32604143 missense possibly damaging 0.50
coquet UTSW 11 32577764 missense
legacy UTSW 11 32604166 nonsense probably null
mignon UTSW 11 32587363 missense probably damaging 1.00
R0481_stk10_383 UTSW 11 32614708 missense probably damaging 1.00
FR4976:Stk10 UTSW 11 32614520 critical splice acceptor site probably benign
R0003:Stk10 UTSW 11 32589460 missense probably benign 0.05
R0008:Stk10 UTSW 11 32587305 splice site probably benign
R0056:Stk10 UTSW 11 32617851 missense possibly damaging 0.95
R0076:Stk10 UTSW 11 32603722 missense probably benign
R0227:Stk10 UTSW 11 32617859 missense probably damaging 1.00
R0440:Stk10 UTSW 11 32604190 missense probably damaging 1.00
R0454:Stk10 UTSW 11 32596724 missense probably damaging 0.99
R0481:Stk10 UTSW 11 32614708 missense probably damaging 1.00
R0504:Stk10 UTSW 11 32617882 missense probably benign 0.04
R0790:Stk10 UTSW 11 32598653 missense probably benign 0.00
R1439:Stk10 UTSW 11 32617919 missense probably damaging 0.98
R1539:Stk10 UTSW 11 32533440 missense possibly damaging 0.85
R1770:Stk10 UTSW 11 32622464 missense possibly damaging 0.94
R4430:Stk10 UTSW 11 32533552 missense possibly damaging 0.81
R4702:Stk10 UTSW 11 32555172 missense probably benign 0.28
R4797:Stk10 UTSW 11 32598471 missense probably benign 0.01
R5447:Stk10 UTSW 11 32604166 nonsense probably null
R5801:Stk10 UTSW 11 32596748 missense probably benign 0.01
R5802:Stk10 UTSW 11 32596748 missense probably benign 0.01
R6129:Stk10 UTSW 11 32615871 missense probably damaging 1.00
R6154:Stk10 UTSW 11 32603654 splice site probably null
R6175:Stk10 UTSW 11 32603761 missense possibly damaging 0.46
R6185:Stk10 UTSW 11 32577749 missense probably benign 0.13
R6520:Stk10 UTSW 11 32588839 missense probably damaging 1.00
R6824:Stk10 UTSW 11 32587363 missense probably damaging 1.00
R7259:Stk10 UTSW 11 32598497 missense probably benign 0.00
R7649:Stk10 UTSW 11 32577764 missense
R8331:Stk10 UTSW 11 32588928 missense
R8847:Stk10 UTSW 11 32589427 missense
X0027:Stk10 UTSW 11 32587361 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ATTCTCTGGCCAGAAACAGGAG -3'
(R):5'- AGGCCTGGGCAGCTTAAAAG -3'

Sequencing Primer
(F):5'- CAGGGATCCTGCAGAAGC -3'
(R):5'- CTTAAAAGAAGGGGCCAGCTGC -3'
Posted On2017-12-01