Incidental Mutation 'R4278:Ccdc187'
ID500527
Institutional Source Beutler Lab
Gene Symbol Ccdc187
Ensembl Gene ENSMUSG00000048038
Gene Namecoiled-coil domain containing 187
Synonyms4932418E24Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.107) question?
Stock #R4278 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location26243469-26294557 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to A at 26282227 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000150719 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057224] [ENSMUST00000217256] [ENSMUST00000227200]
Predicted Effect probably benign
Transcript: ENSMUST00000057224
SMART Domains Protein: ENSMUSP00000054283
Gene: ENSMUSG00000048038

DomainStartEndE-ValueType
low complexity region 116 132 N/A INTRINSIC
low complexity region 536 557 N/A INTRINSIC
coiled coil region 605 632 N/A INTRINSIC
coiled coil region 717 745 N/A INTRINSIC
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000217256
Predicted Effect unknown
Transcript: ENSMUST00000227200
AA Change: D281V
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anln A G 9: 22,334,000 probably null Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Capza3 T A 6: 140,042,060 Y128* probably null Het
Dpp4 T C 2: 62,379,323 R119G probably damaging Het
Espn T C 4: 152,134,417 D308G probably damaging Het
Gm9857 T C 3: 108,940,103 probably benign Het
Hhatl G A 9: 121,784,219 A470V probably benign Het
Igfals A T 17: 24,881,217 E427D probably benign Het
Il22ra1 C T 4: 135,750,713 A365V possibly damaging Het
Kctd6 G C 14: 8,222,806 R216P probably damaging Het
Lama1 A T 17: 67,791,517 M1864L probably null Het
Mbd5 T G 2: 49,272,293 I37S probably damaging Het
Nsf C A 11: 103,930,806 A5S probably damaging Het
Nsun5 A G 5: 135,370,060 Y26C probably damaging Het
Olfr1500 A G 19: 13,828,429 probably benign Het
Pitpnm3 C T 11: 72,074,516 V164I probably damaging Het
Plk2 A G 13: 110,396,103 K117R probably benign Het
Ppp1r13b G T 12: 111,830,384 N908K probably damaging Het
Rapgef4 T A 2: 72,198,395 N385K possibly damaging Het
Rbp3 G A 14: 33,958,650 V1070I probably benign Het
Rhbdd3 C T 11: 5,105,329 T226I probably benign Het
Slc27a3 C T 3: 90,389,188 probably benign Het
Slc30a2 G A 4: 134,346,049 E136K probably null Het
Sptlc2 A C 12: 87,336,151 I393R probably benign Het
Tmem260 C T 14: 48,477,636 T249M probably damaging Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Uhrf1bp1l T G 10: 89,806,709 probably null Het
Vmn1r80 G T 7: 12,193,527 C188F probably benign Het
Vwa2 C A 19: 56,903,483 Q283K probably benign Het
Zfp52 A G 17: 21,561,870 K660R probably benign Het
Other mutations in Ccdc187
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01868:Ccdc187 APN 2 26280948 missense probably benign
IGL02989:Ccdc187 APN 2 26276431 missense possibly damaging 0.92
IGL03017:Ccdc187 APN 2 26280966 missense probably benign
IGL03059:Ccdc187 APN 2 26294241 missense probably null 1.00
IGL03117:Ccdc187 APN 2 26287968 missense possibly damaging 0.95
R0026:Ccdc187 UTSW 2 26281353 missense probably benign 0.00
R0144:Ccdc187 UTSW 2 26276203 missense probably damaging 0.98
R1078:Ccdc187 UTSW 2 26294377 missense probably damaging 0.98
R1226:Ccdc187 UTSW 2 26276121 missense probably damaging 0.99
R1624:Ccdc187 UTSW 2 26281075 missense probably benign
R1733:Ccdc187 UTSW 2 26293658 missense possibly damaging 0.93
R1851:Ccdc187 UTSW 2 26276068 missense probably benign 0.17
R2304:Ccdc187 UTSW 2 26281017 missense possibly damaging 0.94
R4344:Ccdc187 UTSW 2 26280669 missense probably damaging 1.00
R5151:Ccdc187 UTSW 2 26293439 missense probably damaging 1.00
R5416:Ccdc187 UTSW 2 26276092 missense possibly damaging 0.87
R5537:Ccdc187 UTSW 2 26276225 missense probably benign 0.32
R5761:Ccdc187 UTSW 2 26276092 missense possibly damaging 0.87
R5762:Ccdc187 UTSW 2 26276092 missense possibly damaging 0.87
R5865:Ccdc187 UTSW 2 26293368 missense probably benign 0.00
R5925:Ccdc187 UTSW 2 26293581 missense probably benign
R6261:Ccdc187 UTSW 2 26276203 missense probably damaging 0.98
R6803:Ccdc187 UTSW 2 26289779 missense probably benign 0.02
R6888:Ccdc187 UTSW 2 26289734 missense probably damaging 0.98
R6958:Ccdc187 UTSW 2 26289719 missense probably benign
R7006:Ccdc187 UTSW 2 26281090 missense probably benign 0.05
R7358:Ccdc187 UTSW 2 26255995 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AAATGTTCTCTGTGCCCACC -3'
(R):5'- ATAACCTCCATTGAGCAGGC -3'

Sequencing Primer
(F):5'- TGTGCCCACCCACTAATGC -3'
(R):5'- CTATTACAGAGATGCACCATGCTGG -3'
Posted On2017-12-01