Incidental Mutation 'R4359:Lpcat2'
ID500579
Institutional Source Beutler Lab
Gene Symbol Lpcat2
Ensembl Gene ENSMUSG00000033192
Gene Namelysophosphatidylcholine acyltransferase 2
SynonymslysoPAFAT/LPCAT2, LPCAT2, Aytl1a, Aytl1
MMRRC Submission 041670-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.143) question?
Stock #R4359 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location92855339-92919279 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 92873106 bp
ZygosityHeterozygous
Amino Acid Change Proline to Glutamine at position 234 (P234Q)
Ref Sequence ENSEMBL: ENSMUSP00000049252 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046290] [ENSMUST00000209265] [ENSMUST00000210099]
Predicted Effect probably benign
Transcript: ENSMUST00000046290
AA Change: P234Q

PolyPhen 2 Score 0.247 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000049252
Gene: ENSMUSG00000033192
AA Change: P234Q

DomainStartEndE-ValueType
low complexity region 5 12 N/A INTRINSIC
low complexity region 35 45 N/A INTRINSIC
transmembrane domain 59 81 N/A INTRINSIC
PlsC 140 251 2.78e-22 SMART
Blast:PlsC 284 326 3e-19 BLAST
EFh 395 423 4.49e-4 SMART
EFh 432 460 6.11e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130471
Predicted Effect probably benign
Transcript: ENSMUST00000209265
Predicted Effect probably benign
Transcript: ENSMUST00000210099
Meta Mutation Damage Score 0.0754 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the lysophospholipid acyltransferase family. The encoded enzyme may function in two ways: to catalyze the biosynthesis of platelet-activating factor (1-O-alkyl-2-acetyl-sn-glycero-3-phosphocholine) from 1-O-alkyl-sn-glycero-3-phosphocholine, and to catalyze the synthesis of glycerophospholipid precursors from arachidonyl-CoA and lysophosphatidylcholine. The encoded protein may function in membrane biogenesis and production of platelet-activating factor in inflammatory cells. The enzyme may localize to the endoplasmic reticulum and the Golgi. [provided by RefSeq, Feb 2009]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931440F15Rik A T 11: 29,824,669 S263T probably benign Het
Abca13 G T 11: 9,297,629 V2459F probably benign Het
Acot1 T C 12: 84,014,540 Y207H probably damaging Het
Anapc1 A G 2: 128,623,556 V1668A possibly damaging Het
Atr T A 9: 95,951,536 I2613N probably damaging Het
Baz2b A G 2: 59,901,613 I2027T possibly damaging Het
C2cd3 T G 7: 100,441,089 H466Q probably damaging Het
Cdc14b T A 13: 64,248,411 I15F probably benign Het
Cep135 G T 5: 76,611,714 K438N possibly damaging Het
Cnot1 T C 8: 95,739,848 D1587G probably damaging Het
Cxcl16 C A 11: 70,458,805 V65L possibly damaging Het
Dhx36 T A 3: 62,475,278 T783S probably benign Het
Disp3 T C 4: 148,271,932 N157S probably benign Het
Gfod2 T C 8: 105,717,545 N122S possibly damaging Het
Gm11639 G T 11: 104,733,721 probably null Het
Grin3b T A 10: 79,972,897 D160E probably benign Het
Grm7 G T 6: 110,646,348 V161F probably damaging Het
Htr1b C A 9: 81,632,351 A68S probably benign Het
Ifit2 A T 19: 34,573,144 D28V possibly damaging Het
Ifna15 G T 4: 88,557,842 T135N probably benign Het
Igsf9b G A 9: 27,309,478 V47I possibly damaging Het
Kif24 A G 4: 41,413,827 probably null Het
Klhl25 T C 7: 75,866,732 V462A probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
L3mbtl3 A G 10: 26,327,741 V397A unknown Het
Lrp1b A C 2: 40,903,065 C2532W probably damaging Het
Malt1 T C 18: 65,476,229 V768A probably benign Het
Mindy3 A T 2: 12,396,209 W233R probably damaging Het
Ncor1 T C 11: 62,358,910 K1054R probably damaging Het
Nin T A 12: 70,014,938 T2051S probably benign Het
Olfr16 C A 1: 172,957,080 A95E probably benign Het
Olfr616 A G 7: 103,564,535 F248S probably benign Het
Pcsk1 T C 13: 75,112,719 S354P possibly damaging Het
Pilra T C 5: 137,831,314 T160A probably benign Het
Plekha5 G C 6: 140,591,688 E540D probably benign Het
Prps2 T A X: 167,363,549 K176* probably null Het
Rasgrf2 C A 13: 91,890,677 D1017Y probably damaging Het
Slc15a4 A G 5: 127,604,536 probably null Het
Spsb1 T C 4: 149,906,775 H112R probably damaging Het
Srd5a3 T A 5: 76,147,700 F79Y probably damaging Het
Stxbp4 C T 11: 90,494,644 W506* probably null Het
Timeless C A 10: 128,247,342 Q653K probably benign Het
Trio G A 15: 27,749,797 Q1129* probably null Het
Vrk3 C T 7: 44,775,442 T427M probably benign Het
Zzef1 T A 11: 72,823,508 S275T probably damaging Het
Other mutations in Lpcat2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00737:Lpcat2 APN 8 92909206 missense probably damaging 1.00
IGL00823:Lpcat2 APN 8 92864970 missense possibly damaging 0.90
IGL00911:Lpcat2 APN 8 92890710 missense probably damaging 0.99
IGL01449:Lpcat2 APN 8 92871147 missense possibly damaging 0.69
IGL01951:Lpcat2 APN 8 92918047 missense probably damaging 1.00
IGL02041:Lpcat2 APN 8 92918181 missense probably benign 0.04
IGL02491:Lpcat2 APN 8 92874251 missense probably damaging 1.00
IGL02957:Lpcat2 APN 8 92875584 nonsense probably null
R0960:Lpcat2 UTSW 8 92869710 missense probably benign
R1236:Lpcat2 UTSW 8 92886569 missense probably damaging 1.00
R1422:Lpcat2 UTSW 8 92879417 missense probably damaging 1.00
R1677:Lpcat2 UTSW 8 92864932 missense probably benign 0.08
R2048:Lpcat2 UTSW 8 92869843 missense possibly damaging 0.94
R3712:Lpcat2 UTSW 8 92918170 missense possibly damaging 0.70
R3919:Lpcat2 UTSW 8 92914274 missense probably damaging 0.99
R3951:Lpcat2 UTSW 8 92864903 missense probably benign
R4357:Lpcat2 UTSW 8 92873106 missense probably benign 0.25
R4358:Lpcat2 UTSW 8 92873106 missense probably benign 0.25
R4401:Lpcat2 UTSW 8 92873055 missense possibly damaging 0.61
R4584:Lpcat2 UTSW 8 92889371 missense probably damaging 1.00
R5089:Lpcat2 UTSW 8 92879443 missense probably damaging 1.00
R5127:Lpcat2 UTSW 8 92909191 missense possibly damaging 0.65
R5185:Lpcat2 UTSW 8 92869737 missense probably benign 0.04
R6380:Lpcat2 UTSW 8 92886581 missense probably benign
R6974:Lpcat2 UTSW 8 92873079 missense probably damaging 1.00
R7171:Lpcat2 UTSW 8 92909266 missense probably benign 0.00
R7344:Lpcat2 UTSW 8 92875567 missense probably damaging 0.98
R7356:Lpcat2 UTSW 8 92864983 missense probably benign
R7684:Lpcat2 UTSW 8 92909195 missense possibly damaging 0.91
R7834:Lpcat2 UTSW 8 92918101 missense possibly damaging 0.63
R7917:Lpcat2 UTSW 8 92918101 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- GTGGAACAAGCTGAGTCCAG -3'
(R):5'- GCAGACGAATGCACATGTG -3'

Sequencing Primer
(F):5'- CCAGCTTTTATTCGAATCAAGAGTC -3'
(R):5'- AGGCTACATCAAAAAGGAGAGC -3'
Posted On2017-12-01