Incidental Mutation 'R4376:Csf1'
ID500586
Institutional Source Beutler Lab
Gene Symbol Csf1
Ensembl Gene ENSMUSG00000014599
Gene Namecolony stimulating factor 1 (macrophage)
Synonymscolony-stimulating factor-1, CSF-1, Csfm, M-CSF
MMRRC Submission 041120-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.727) question?
Stock #R4376 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location107741048-107760469 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 107756739 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 38 (T38S)
Ref Sequence ENSEMBL: ENSMUSP00000115480 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014743] [ENSMUST00000118593] [ENSMUST00000120243] [ENSMUST00000153114]
Predicted Effect possibly damaging
Transcript: ENSMUST00000014743
AA Change: T14S

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000014743
Gene: ENSMUSG00000014599
AA Change: T14S

DomainStartEndE-ValueType
Pfam:CSF-1 1 254 6.8e-91 PFAM
Pfam:CSF-1 272 552 1.1e-147 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000118593
AA Change: T14S

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000113136
Gene: ENSMUSG00000014599
AA Change: T14S

DomainStartEndE-ValueType
Pfam:CSF-1 1 257 9.5e-123 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000120243
AA Change: T14S

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000113617
Gene: ENSMUSG00000014599
AA Change: T14S

DomainStartEndE-ValueType
Pfam:CSF-1 1 254 6.8e-91 PFAM
Pfam:CSF-1 272 552 1.1e-147 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000153114
AA Change: T38S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000115480
Gene: ENSMUSG00000014599
AA Change: T38S

DomainStartEndE-ValueType
Pfam:CSF-1 26 182 1.1e-54 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155557
Meta Mutation Damage Score 0.3270 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cytokine that controls the production, differentiation, and function of macrophages. The active form of the protein is found extracellularly as a disulfide-linked homodimer, and is thought to be produced by proteolytic cleavage of membrane-bound precursors. The encoded protein may be involved in development of the placenta. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygotes for a spontaneous mutation exhibit lack of incisors, a broad domed skull, short thick limb bones with reduced marrow cavities, impaired hearing and vision, and reduced fertility in females. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg6 G A 10: 14,469,050 T53M probably damaging Het
Adgrg6 A G 10: 14,438,494 S683P probably benign Het
Atp10d T C 5: 72,296,975 L189P probably damaging Het
C330007P06Rik C A X: 36,824,159 C206F probably benign Het
Eaf2 A G 16: 36,800,636 L184P unknown Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Fam83e A T 7: 45,723,893 S228C probably damaging Het
Gon4l C A 3: 88,907,387 P1888T probably benign Het
Kit T C 5: 75,640,499 I515T probably benign Het
Kmt2c C T 5: 25,315,326 V1929I probably benign Het
March11 A G 15: 26,309,446 E62G probably damaging Het
Mlh3 C A 12: 85,259,198 R1175L probably benign Het
Mrps2 T C 2: 28,468,859 S67P probably benign Het
Nlrp12 A G 7: 3,240,946 L312P possibly damaging Het
Olfr1228 T C 2: 89,249,245 R150G possibly damaging Het
Olfr275 A T 4: 52,826,195 N266I possibly damaging Het
Osbpl8 T A 10: 111,269,419 I245N possibly damaging Het
Pank1 C T 19: 34,877,704 V4I probably benign Het
Pdia4 G A 6: 47,798,392 R495W probably damaging Het
Pfn4 T A 12: 4,770,182 D10E probably damaging Het
Plce1 T C 19: 38,705,447 probably null Het
Pole T A 5: 110,337,205 I395K possibly damaging Het
Polq G T 16: 37,013,181 V79F probably damaging Het
Prcc A G 3: 87,867,407 Y363H probably damaging Het
Rictor T C 15: 6,786,967 V1240A probably benign Het
Slc14a2 G A 18: 78,207,068 R62C probably damaging Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Tsnaxip1 C A 8: 105,841,801 C372* probably null Het
Ttc23l CT CTTGGATT 15: 10,537,562 probably benign Het
Ttc23l G A 15: 10,537,566 S206L probably benign Het
Other mutations in Csf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00582:Csf1 APN 3 107756727 missense probably benign 0.00
IGL00907:Csf1 APN 3 107750346 missense probably damaging 1.00
IGL01644:Csf1 APN 3 107753842 missense possibly damaging 0.84
R0022:Csf1 UTSW 3 107753862 missense probably damaging 0.99
R0025:Csf1 UTSW 3 107748644 missense probably benign
R0025:Csf1 UTSW 3 107748644 missense probably benign
R0350:Csf1 UTSW 3 107748606 missense probably benign 0.01
R1392:Csf1 UTSW 3 107756630 missense probably benign 0.03
R1392:Csf1 UTSW 3 107756630 missense probably benign 0.03
R1531:Csf1 UTSW 3 107748338 missense possibly damaging 0.72
R1897:Csf1 UTSW 3 107748279 missense probably damaging 1.00
R4373:Csf1 UTSW 3 107756739 missense probably damaging 1.00
R4375:Csf1 UTSW 3 107756739 missense probably damaging 1.00
R4377:Csf1 UTSW 3 107756739 missense probably damaging 1.00
R4469:Csf1 UTSW 3 107750681 critical splice donor site probably null
R4474:Csf1 UTSW 3 107753856 missense probably damaging 0.98
R4604:Csf1 UTSW 3 107756962 splice site probably null
R4634:Csf1 UTSW 3 107749167 missense probably damaging 0.96
R5086:Csf1 UTSW 3 107748710 missense possibly damaging 0.72
R5156:Csf1 UTSW 3 107748936 missense probably benign 0.01
R5425:Csf1 UTSW 3 107748896 missense possibly damaging 0.96
R6120:Csf1 UTSW 3 107753854 missense probably damaging 0.96
R6268:Csf1 UTSW 3 107747157 missense possibly damaging 0.86
R6269:Csf1 UTSW 3 107749001 missense probably benign 0.04
R6273:Csf1 UTSW 3 107749163 missense probably damaging 1.00
R6298:Csf1 UTSW 3 107748359 missense possibly damaging 0.96
R7196:Csf1 UTSW 3 107753898 missense possibly damaging 0.91
R7375:Csf1 UTSW 3 107748179 missense possibly damaging 0.96
R7437:Csf1 UTSW 3 107750756 missense probably benign 0.00
R7464:Csf1 UTSW 3 107748875 missense probably benign 0.03
R7780:Csf1 UTSW 3 107750393 missense probably damaging 0.96
R7808:Csf1 UTSW 3 107760045 missense possibly damaging 0.70
R8153:Csf1 UTSW 3 107748704 missense probably damaging 0.98
Z1177:Csf1 UTSW 3 107749080 missense possibly damaging 0.70
Predicted Primers PCR Primer
(F):5'- TGGAAGCCTCTCTTTGACTCTG -3'
(R):5'- GCTCTGGGTTAACCTCAGAAGAG -3'

Sequencing Primer
(F):5'- TCTTTGACTCTGCCTTCTGG -3'
(R):5'- GTTAACCTCAGAAGAGTTCTTGGAG -3'
Posted On2017-12-01