Incidental Mutation 'R4430:Sytl4'
ID 500605
Institutional Source Beutler Lab
Gene Symbol Sytl4
Ensembl Gene ENSMUSG00000031255
Gene Name synaptotagmin-like 4
Synonyms granuphilin-b, Slp4, granuphilin-a
MMRRC Submission 041700-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock # R4430 (G1)
Quality Score 222
Status Not validated
Chromosome X
Chromosomal Location 133936385-133981812 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G,T at 133949223 bp (GRCm38)
Zygosity Homozygous
Amino Acid Change Serine to Arginine at position 338 (S338R)
Ref Sequence ENSEMBL: ENSMUSP00000108922 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033608] [ENSMUST00000113294] [ENSMUST00000113297]
AlphaFold Q9R0Q1
Predicted Effect probably damaging
Transcript: ENSMUST00000033608
AA Change: S338R

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000033608
Gene: ENSMUSG00000031255
AA Change: S338R

DomainStartEndE-ValueType
RING 63 105 2.84e-1 SMART
low complexity region 169 180 N/A INTRINSIC
low complexity region 194 222 N/A INTRINSIC
coiled coil region 305 326 N/A INTRINSIC
C2 374 479 9.98e-16 SMART
C2 529 634 3.37e-13 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113294
AA Change: S338R

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000108919
Gene: ENSMUSG00000031255
AA Change: S338R

DomainStartEndE-ValueType
RING 63 105 2.84e-1 SMART
low complexity region 169 180 N/A INTRINSIC
low complexity region 194 222 N/A INTRINSIC
coiled coil region 305 326 N/A INTRINSIC
C2 374 479 9.98e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113297
AA Change: S338R

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000108922
Gene: ENSMUSG00000031255
AA Change: S338R

DomainStartEndE-ValueType
RING 63 105 2.84e-1 SMART
low complexity region 169 180 N/A INTRINSIC
low complexity region 194 222 N/A INTRINSIC
coiled coil region 305 326 N/A INTRINSIC
C2 374 479 9.98e-16 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the synaptotagmin like protein family. Members of this family are characterized by an N-terminal Rab27 binding domain and C-terminal tandem C2 domains. The encoded protein binds specific small Rab GTPases and is involved in intracellular membrane trafficking. This protein binds Rab27 and may be involved in inhibiting dense core vesicle exocytosis. Alternate splicing results in multiple transcript variants that encode the same protein. [provided by RefSeq, Mar 2010]
PHENOTYPE: Targeted inactivation of this gene leads to reduced body weight, enhanced glucose tolerance, defective granule docking at the plasma membrane in pancreatic beta cells and corticotrophs, and a significant increase in evoked insulin and adrenocorticotropinsecretion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik G T 5: 63,898,839 probably benign Het
Aak1 A G 6: 86,986,366 N926S unknown Het
Ahi1 T A 10: 20,972,078 C462S probably damaging Het
Ahnak A G 19: 9,003,040 I563V probably benign Het
Ankrd55 G A 13: 112,323,183 probably null Het
Bag3 A G 7: 128,523,923 D22G probably damaging Het
Cldn8 A C 16: 88,562,731 M102R probably damaging Het
Col15a1 T C 4: 47,245,705 F152S probably damaging Het
Cxcr2 T C 1: 74,158,845 I166T probably benign Het
Dnah11 T C 12: 117,983,011 I3113V probably benign Het
Gli2 T C 1: 118,837,244 H1059R probably benign Het
Gm14412 C A 2: 177,315,832 S90I probably benign Het
L1td1 A G 4: 98,737,151 R528G probably benign Het
Mcm3 A T 1: 20,811,993 L449* probably null Het
Mif4gd T C 11: 115,608,502 T185A probably benign Het
Mphosph9 T C 5: 124,265,446 S840G possibly damaging Het
Nim1k C A 13: 119,712,542 R272L possibly damaging Het
Olfr1079 A G 2: 86,538,387 I176T probably damaging Het
Olfr1457 C T 19: 13,095,088 V187I probably benign Het
Olfr806 T A 10: 129,738,261 I219F probably damaging Het
Pax3 A G 1: 78,195,324 V83A probably damaging Het
Pde3b C T 7: 114,534,670 P974S probably damaging Het
Pdzd3 C T 9: 44,249,744 S175N probably benign Het
Pglyrp3 T A 3: 92,031,491 D324E probably damaging Het
Pus7 A G 5: 23,746,489 Y521H probably benign Het
Ryr2 A G 13: 11,735,527 S1953P probably damaging Het
Sost G A 11: 101,966,844 P44S probably damaging Het
Sox5 A G 6: 144,041,274 I188T possibly damaging Het
Spata4 T C 8: 54,601,843 I86T probably benign Het
Ssc5d T C 7: 4,943,664 S1006P probably benign Het
Stk10 T C 11: 32,533,552 V50A possibly damaging Het
Sytl5 A T X: 9,960,023 N412Y probably damaging Het
Tert T A 13: 73,627,475 F115Y probably damaging Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Tmem201 A C 4: 149,731,139 V118G probably benign Het
Tmem67 T A 4: 12,051,473 N785I possibly damaging Het
Trhde A T 10: 114,503,123 L594Q probably damaging Het
Ugt2b37 T C 5: 87,254,092 M227V probably benign Het
Vmn2r22 T C 6: 123,637,858 T258A possibly damaging Het
Vmn2r73 A T 7: 85,870,241 M503K probably benign Het
Zfp54 T G 17: 21,434,960 V572G probably damaging Het
Other mutations in Sytl4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02999:Sytl4 APN X 133937978 missense probably benign 0.00
R0463:Sytl4 UTSW X 133962187 missense probably benign 0.01
R0608:Sytl4 UTSW X 133962187 missense probably benign 0.01
R1335:Sytl4 UTSW X 133961126 splice site probably benign
X0066:Sytl4 UTSW X 133949110 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- GAAGCACTCACGGGTTAGAACG -3'
(R):5'- CAAGAGTCTGTGTGAGCCAG -3'

Sequencing Primer
(F):5'- AGAACGCTTCTTGGCTTCATCAG -3'
(R):5'- ACTCAAGCAATTGTGGATGTG -3'
Posted On 2017-12-01