Incidental Mutation 'R4415:Impdh1'
ID500610
Institutional Source Beutler Lab
Gene Symbol Impdh1
Ensembl Gene ENSMUSG00000003500
Gene Nameinosine monophosphate dehydrogenase 1
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.244) question?
Stock #R4415 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location29200434-29216364 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 29209222 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 49 (V49M)
Ref Sequence ENSEMBL: ENSMUSP00000125235 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078155] [ENSMUST00000159124] [ENSMUST00000160749] [ENSMUST00000160878] [ENSMUST00000162099] [ENSMUST00000162215] [ENSMUST00000162739]
Predicted Effect probably damaging
Transcript: ENSMUST00000078155
AA Change: V49M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000077289
Gene: ENSMUSG00000003500
AA Change: V49M

DomainStartEndE-ValueType
IMPDH 28 504 6.73e-263 SMART
CBS 117 168 6.49e-10 SMART
CBS 184 232 3.37e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000159124
AA Change: V49M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124931
Gene: ENSMUSG00000003500
AA Change: V49M

DomainStartEndE-ValueType
IMPDH 28 504 6.73e-263 SMART
CBS 117 168 6.49e-10 SMART
CBS 184 232 3.37e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160613
Predicted Effect probably damaging
Transcript: ENSMUST00000160749
AA Change: V49M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000125488
Gene: ENSMUSG00000003500
AA Change: V49M

DomainStartEndE-ValueType
Pfam:IMPDH 28 84 3.9e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000160878
AA Change: V49M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124269
Gene: ENSMUSG00000003500
AA Change: V49M

DomainStartEndE-ValueType
IMPDH 28 479 2.97e-232 SMART
CBS 92 143 6.49e-10 SMART
CBS 159 207 3.37e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161654
Predicted Effect probably damaging
Transcript: ENSMUST00000162099
AA Change: V49M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124541
Gene: ENSMUSG00000003500
AA Change: V49M

DomainStartEndE-ValueType
IMPDH 28 504 6.73e-263 SMART
CBS 117 168 6.49e-10 SMART
CBS 184 232 3.37e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000162215
AA Change: V49M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125235
Gene: ENSMUSG00000003500
AA Change: V49M

DomainStartEndE-ValueType
IMPDH 28 231 5.75e-17 SMART
CBS 161 209 3.37e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000162739
AA Change: V73M

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000125077
Gene: ENSMUSG00000003500
AA Change: V73M

DomainStartEndE-ValueType
low complexity region 8 22 N/A INTRINSIC
low complexity region 32 61 N/A INTRINSIC
IMPDH 86 558 2e-256 SMART
CBS 171 222 6.49e-10 SMART
CBS 238 286 3.37e-8 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene acts as a homotetramer to regulate cell growth. The encoded protein is an enzyme that catalyzes the synthesis of xanthine monophosphate (XMP) from inosine-5'-monophosphate (IMP). This is the rate-limiting step in the de novo synthesis of guanine nucleotides. Defects in this gene are a cause of retinitis pigmentosa type 10 (RP10). Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2008]
PHENOTYPE: Mic homozygous for disruptions of this gene display abnormalities in T cell proliferation. Mice homozygous for an ENU-induced mutation exhibit reduced thickness of the outer nuclear layer and total retina thickness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik T C 4: 41,505,574 T183A possibly damaging Het
Ace3 A T 11: 106,005,121 D631V probably benign Het
Adam17 T C 12: 21,345,701 I274V possibly damaging Het
Aebp1 A G 11: 5,865,451 D303G probably damaging Het
B020004C17Rik T C 14: 57,017,417 *233R probably null Het
Bcl9l C T 9: 44,501,879 P127S possibly damaging Het
Bdp1 T C 13: 100,030,861 D2215G probably damaging Het
Caly T C 7: 140,072,680 T52A probably damaging Het
Ccdc125 T C 13: 100,696,309 S465P possibly damaging Het
Cdc23 ACC AC 18: 34,637,318 probably null Het
Colq T C 14: 31,535,688 K231E probably damaging Het
Fam32a T A 8: 72,221,941 I77N probably damaging Het
Gm597 T A 1: 28,777,133 Q606L probably benign Het
Kcnh7 A G 2: 62,706,073 I1055T probably damaging Het
Lad1 A G 1: 135,828,746 D364G probably benign Het
Lama2 G T 10: 26,989,344 Y947* probably null Het
Myo5b T A 18: 74,580,408 I108N probably damaging Het
Nvl T C 1: 181,105,114 T713A probably benign Het
Oit3 T C 10: 59,428,103 Y403C probably damaging Het
Olfr814 T C 10: 129,873,957 T267A probably benign Het
Pappa A G 4: 65,305,295 T1236A probably benign Het
Rcl1 G A 19: 29,118,362 V116I probably benign Het
Rdh14 G A 12: 10,391,231 probably null Het
Rfx2 T A 17: 56,787,733 T204S possibly damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Ripor1 T C 8: 105,617,976 S581P probably benign Het
Rnf213 T A 11: 119,483,964 V5084E probably damaging Het
Scn9a A T 2: 66,526,693 V1077E probably damaging Het
Slc15a5 A G 6: 138,079,756 V54A probably benign Het
Slc35b2 G A 17: 45,566,429 V161M probably benign Het
Snx19 T A 9: 30,437,483 L804Q probably damaging Het
Specc1l C A 10: 75,246,328 N519K possibly damaging Het
Stambp A T 6: 83,557,482 N274K probably damaging Het
Stox1 T C 10: 62,659,569 N975S probably benign Het
Tacc3 T G 5: 33,666,684 probably null Het
Tmem55a C T 4: 14,912,463 R191C probably damaging Het
Tubb1 G A 2: 174,457,673 E383K probably benign Het
Ube3b A T 5: 114,412,444 D844V probably damaging Het
Other mutations in Impdh1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01543:Impdh1 APN 6 29203378 missense probably damaging 0.97
IGL01642:Impdh1 APN 6 29207166 missense possibly damaging 0.57
IGL02187:Impdh1 APN 6 29207087 splice site probably benign
IGL02294:Impdh1 APN 6 29205202 missense probably benign 0.19
IGL02570:Impdh1 APN 6 29203198 missense probably damaging 1.00
IGL02858:Impdh1 APN 6 29206925 nonsense probably null
IGL02874:Impdh1 APN 6 29203156 missense probably damaging 1.00
steve UTSW 6 29204632 nonsense probably null
R0089:Impdh1 UTSW 6 29206326 missense probably benign
R0855:Impdh1 UTSW 6 29206972 missense probably damaging 1.00
R1331:Impdh1 UTSW 6 29206478 missense probably damaging 0.96
R1797:Impdh1 UTSW 6 29207169 missense probably damaging 0.98
R1824:Impdh1 UTSW 6 29205088 missense probably benign 0.08
R1981:Impdh1 UTSW 6 29206451 missense possibly damaging 0.70
R2076:Impdh1 UTSW 6 29205163 missense probably damaging 0.99
R3841:Impdh1 UTSW 6 29202769 missense probably damaging 0.98
R4020:Impdh1 UTSW 6 29202694 missense probably benign 0.01
R4471:Impdh1 UTSW 6 29204632 nonsense probably null
R4777:Impdh1 UTSW 6 29205202 missense possibly damaging 0.95
R5783:Impdh1 UTSW 6 29206343 missense possibly damaging 0.66
R5973:Impdh1 UTSW 6 29207162 missense probably damaging 1.00
R7230:Impdh1 UTSW 6 29206063 splice site probably null
R7512:Impdh1 UTSW 6 29207169 missense probably benign 0.22
R8686:Impdh1 UTSW 6 29216215 start gained probably benign
Predicted Primers PCR Primer
(F):5'- GACCTTTTCTGAGCCAACCC -3'
(R):5'- GTCAGTGGATTCCAGCCTTTC -3'

Sequencing Primer
(F):5'- ACTTCTTCAGTGACAGAGCATC -3'
(R):5'- AGTGGATTCCAGCCTTTCTGCTC -3'
Posted On2017-12-01