Mutagenetix > Incidental Mutations

Incidental Mutation 'R4415:Impdh1'

500610

Institutional Source

Beutler Lab

Gene Symbol

Impdh1

Ensembl Gene

ENSMUSG00000003500

Gene Name

inosine monophosphate dehydrogenase 1

Synonyms

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.244) question?

Stock #

R4415 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

29200434-29216364 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 29209222 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Methionine at position 49 (V49M)

Ref Sequence

ENSEMBL: ENSMUSP00000125235 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000078155] [ENSMUST00000159124] [ENSMUST00000160749] [ENSMUST00000160878] [ENSMUST00000162099] [ENSMUST00000162215] [ENSMUST00000162739]

Predicted Effect

probably damaging
Transcript: ENSMUST00000078155
AA Change: V49M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000077289
Gene: ENSMUSG00000003500
AA Change: V49M

Domain	Start	End	E-Value	Type
IMPDH	28	504	6.73e-263	SMART
CBS	117	168	6.49e-10	SMART
CBS	184	232	3.37e-8	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000159124
AA Change: V49M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000124931
Gene: ENSMUSG00000003500
AA Change: V49M

Domain	Start	End	E-Value	Type
IMPDH	28	504	6.73e-263	SMART
CBS	117	168	6.49e-10	SMART
CBS	184	232	3.37e-8	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000160613

Predicted Effect

probably damaging
Transcript: ENSMUST00000160749
AA Change: V49M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000125488
Gene: ENSMUSG00000003500
AA Change: V49M

Domain	Start	End	E-Value	Type
Pfam:IMPDH	28	84	3.9e-20	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000160878
AA Change: V49M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000124269
Gene: ENSMUSG00000003500
AA Change: V49M

Domain	Start	End	E-Value	Type
IMPDH	28	479	2.97e-232	SMART
CBS	92	143	6.49e-10	SMART
CBS	159	207	3.37e-8	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161654

Predicted Effect

probably damaging
Transcript: ENSMUST00000162099
AA Change: V49M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000124541
Gene: ENSMUSG00000003500
AA Change: V49M

Domain	Start	End	E-Value	Type
IMPDH	28	504	6.73e-263	SMART
CBS	117	168	6.49e-10	SMART
CBS	184	232	3.37e-8	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000162215
AA Change: V49M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000125235
Gene: ENSMUSG00000003500
AA Change: V49M

Domain	Start	End	E-Value	Type
IMPDH	28	231	5.75e-17	SMART
CBS	161	209	3.37e-8	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000162739
AA Change: V73M

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000125077
Gene: ENSMUSG00000003500
AA Change: V73M

Domain	Start	End	E-Value	Type
low complexity region	8	22	N/A	INTRINSIC
low complexity region	32	61	N/A	INTRINSIC
IMPDH	86	558	2e-256	SMART
CBS	171	222	6.49e-10	SMART
CBS	238	286	3.37e-8	SMART

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene acts as a homotetramer to regulate cell growth. The encoded protein is an enzyme that catalyzes the synthesis of xanthine monophosphate (XMP) from inosine-5'-monophosphate (IMP). This is the rate-limiting step in the de novo synthesis of guanine nucleotides. Defects in this gene are a cause of retinitis pigmentosa type 10 (RP10). Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2008]
PHENOTYPE: Mic homozygous for disruptions of this gene display abnormalities in T cell proliferation. Mice homozygous for an ENU-induced mutation exhibit reduced thickness of the outer nuclear layer and total retina thickness. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110017D15Rik	T	C	4: 41,505,574	T183A	possibly damaging	Het
Ace3	A	T	11: 106,005,121	D631V	probably benign	Het
Adam17	T	C	12: 21,345,701	I274V	possibly damaging	Het
Aebp1	A	G	11: 5,865,451	D303G	probably damaging	Het
B020004C17Rik	T	C	14: 57,017,417	*233R	probably null	Het
Bcl9l	C	T	9: 44,501,879	P127S	possibly damaging	Het
Bdp1	T	C	13: 100,030,861	D2215G	probably damaging	Het
Caly	T	C	7: 140,072,680	T52A	probably damaging	Het
Ccdc125	T	C	13: 100,696,309	S465P	possibly damaging	Het
Cdc23	ACC	AC	18: 34,637,318		probably null	Het
Colq	T	C	14: 31,535,688	K231E	probably damaging	Het
Fam32a	T	A	8: 72,221,941	I77N	probably damaging	Het
Gm597	T	A	1: 28,777,133	Q606L	probably benign	Het
Kcnh7	A	G	2: 62,706,073	I1055T	probably damaging	Het
Lad1	A	G	1: 135,828,746	D364G	probably benign	Het
Lama2	G	T	10: 26,989,344	Y947*	probably null	Het
Myo5b	T	A	18: 74,580,408	I108N	probably damaging	Het
Nvl	T	C	1: 181,105,114	T713A	probably benign	Het
Oit3	T	C	10: 59,428,103	Y403C	probably damaging	Het
Olfr814	T	C	10: 129,873,957	T267A	probably benign	Het
Pappa	A	G	4: 65,305,295	T1236A	probably benign	Het
Rcl1	G	A	19: 29,118,362	V116I	probably benign	Het
Rdh14	G	A	12: 10,391,231		probably null	Het
Rfx2	T	A	17: 56,787,733	T204S	possibly damaging	Het
Rin2	C	T	2: 145,860,446	T354I	probably benign	Het
Ripor1	T	C	8: 105,617,976	S581P	probably benign	Het
Rnf213	T	A	11: 119,483,964	V5084E	probably damaging	Het
Scn9a	A	T	2: 66,526,693	V1077E	probably damaging	Het
Slc15a5	A	G	6: 138,079,756	V54A	probably benign	Het
Slc35b2	G	A	17: 45,566,429	V161M	probably benign	Het
Snx19	T	A	9: 30,437,483	L804Q	probably damaging	Het
Specc1l	C	A	10: 75,246,328	N519K	possibly damaging	Het
Stambp	A	T	6: 83,557,482	N274K	probably damaging	Het
Stox1	T	C	10: 62,659,569	N975S	probably benign	Het
Tacc3	T	G	5: 33,666,684		probably null	Het
Tmem55a	C	T	4: 14,912,463	R191C	probably damaging	Het
Tubb1	G	A	2: 174,457,673	E383K	probably benign	Het
Ube3b	A	T	5: 114,412,444	D844V	probably damaging	Het

Other mutations in Impdh1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01543:Impdh1	APN	6	29203378	missense	probably damaging	0.97
IGL01642:Impdh1	APN	6	29207166	missense	possibly damaging	0.57
IGL02187:Impdh1	APN	6	29207087	splice site	probably benign
IGL02294:Impdh1	APN	6	29205202	missense	probably benign	0.19
IGL02570:Impdh1	APN	6	29203198	missense	probably damaging	1.00
IGL02858:Impdh1	APN	6	29206925	nonsense	probably null
IGL02874:Impdh1	APN	6	29203156	missense	probably damaging	1.00
steve	UTSW	6	29204632	nonsense	probably null
R0089:Impdh1	UTSW	6	29206326	missense	probably benign
R0855:Impdh1	UTSW	6	29206972	missense	probably damaging	1.00
R1331:Impdh1	UTSW	6	29206478	missense	probably damaging	0.96
R1797:Impdh1	UTSW	6	29207169	missense	probably damaging	0.98
R1824:Impdh1	UTSW	6	29205088	missense	probably benign	0.08
R1981:Impdh1	UTSW	6	29206451	missense	possibly damaging	0.70
R2076:Impdh1	UTSW	6	29205163	missense	probably damaging	0.99
R3841:Impdh1	UTSW	6	29202769	missense	probably damaging	0.98
R4020:Impdh1	UTSW	6	29202694	missense	probably benign	0.01
R4471:Impdh1	UTSW	6	29204632	nonsense	probably null
R4777:Impdh1	UTSW	6	29205202	missense	possibly damaging	0.95
R5783:Impdh1	UTSW	6	29206343	missense	possibly damaging	0.66
R5973:Impdh1	UTSW	6	29207162	missense	probably damaging	1.00
R7230:Impdh1	UTSW	6	29206063	splice site	probably null
R7512:Impdh1	UTSW	6	29207169	missense	probably benign	0.22
R8686:Impdh1	UTSW	6	29216215	start gained	probably benign

Predicted Primers

PCR Primer
(F):5'- GACCTTTTCTGAGCCAACCC -3'
(R):5'- GTCAGTGGATTCCAGCCTTTC -3'

Sequencing Primer
(F):5'- ACTTCTTCAGTGACAGAGCATC -3'
(R):5'- AGTGGATTCCAGCCTTTCTGCTC -3'

Posted On

2017-12-01