Incidental Mutation 'R4415:Cdc23'
ID500612
Institutional Source Beutler Lab
Gene Symbol Cdc23
Ensembl Gene ENSMUSG00000024370
Gene NameCDC23 cell division cycle 23
SynonymsD18Ertd243e
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.953) question?
Stock #R4415 (G1)
Quality Score197
Status Not validated
Chromosome18
Chromosomal Location34630951-34651735 bp(-) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) ACC to AC at 34637318 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000122420 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025228] [ENSMUST00000133181] [ENSMUST00000166044] [ENSMUST00000167161]
Predicted Effect probably null
Transcript: ENSMUST00000025228
SMART Domains Protein: ENSMUSP00000025228
Gene: ENSMUSG00000024370

DomainStartEndE-ValueType
Pfam:APC8 22 152 1.9e-42 PFAM
Blast:TPR 175 202 4e-10 BLAST
TPR 263 296 4.21e1 SMART
TPR 331 364 1.74e-4 SMART
TPR 365 398 1.83e-3 SMART
TPR 399 432 1.37e-2 SMART
TPR 433 466 8.97e0 SMART
TPR 510 543 1.82e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133162
Predicted Effect probably null
Transcript: ENSMUST00000133181
SMART Domains Protein: ENSMUSP00000122420
Gene: ENSMUSG00000024370

DomainStartEndE-ValueType
low complexity region 2 24 N/A INTRINSIC
Pfam:ANAPC8 28 151 6.9e-31 PFAM
Blast:TPR 175 202 4e-10 BLAST
TPR 263 296 4.21e1 SMART
TPR 331 364 1.74e-4 SMART
TPR 365 398 1.83e-3 SMART
TPR 399 432 1.37e-2 SMART
TPR 433 466 8.97e0 SMART
TPR 510 543 1.82e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136943
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136949
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138400
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155307
Predicted Effect probably benign
Transcript: ENSMUST00000166044
SMART Domains Protein: ENSMUSP00000132659
Gene: ENSMUSG00000003779

DomainStartEndE-ValueType
KISc 61 514 3.95e-141 SMART
coiled coil region 559 760 N/A INTRINSIC
low complexity region 831 842 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167161
SMART Domains Protein: ENSMUSP00000130045
Gene: ENSMUSG00000003779

DomainStartEndE-ValueType
KISc 61 514 3.95e-141 SMART
coiled coil region 559 760 N/A INTRINSIC
low complexity region 831 842 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene shares strong similarity with Saccharomyces cerevisiae Cdc23, a protein essential for cell cycle progression through the G2/M transition. This protein is a component of anaphase-promoting complex (APC), which is composed of eight protein subunits and highly conserved in eukaryotic cells. APC catalyzes the formation of cyclin B-ubiquitin conjugate that is responsible for the ubiquitin-mediated proteolysis of B-type cyclins. This protein and 3 other members of the APC complex contain the TPR (tetratricopeptide repeat), a protein domain important for protein-protein interaction. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik T C 4: 41,505,574 T183A possibly damaging Het
Ace3 A T 11: 106,005,121 D631V probably benign Het
Adam17 T C 12: 21,345,701 I274V possibly damaging Het
Aebp1 A G 11: 5,865,451 D303G probably damaging Het
B020004C17Rik T C 14: 57,017,417 *233R probably null Het
Bcl9l C T 9: 44,501,879 P127S possibly damaging Het
Bdp1 T C 13: 100,030,861 D2215G probably damaging Het
Caly T C 7: 140,072,680 T52A probably damaging Het
Ccdc125 T C 13: 100,696,309 S465P possibly damaging Het
Colq T C 14: 31,535,688 K231E probably damaging Het
Fam32a T A 8: 72,221,941 I77N probably damaging Het
Gm597 T A 1: 28,777,133 Q606L probably benign Het
Impdh1 C T 6: 29,209,222 V49M probably damaging Het
Kcnh7 A G 2: 62,706,073 I1055T probably damaging Het
Lad1 A G 1: 135,828,746 D364G probably benign Het
Lama2 G T 10: 26,989,344 Y947* probably null Het
Myo5b T A 18: 74,580,408 I108N probably damaging Het
Nvl T C 1: 181,105,114 T713A probably benign Het
Oit3 T C 10: 59,428,103 Y403C probably damaging Het
Olfr814 T C 10: 129,873,957 T267A probably benign Het
Pappa A G 4: 65,305,295 T1236A probably benign Het
Rcl1 G A 19: 29,118,362 V116I probably benign Het
Rdh14 G A 12: 10,391,231 probably null Het
Rfx2 T A 17: 56,787,733 T204S possibly damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Ripor1 T C 8: 105,617,976 S581P probably benign Het
Rnf213 T A 11: 119,483,964 V5084E probably damaging Het
Scn9a A T 2: 66,526,693 V1077E probably damaging Het
Slc15a5 A G 6: 138,079,756 V54A probably benign Het
Slc35b2 G A 17: 45,566,429 V161M probably benign Het
Snx19 T A 9: 30,437,483 L804Q probably damaging Het
Specc1l C A 10: 75,246,328 N519K possibly damaging Het
Stambp A T 6: 83,557,482 N274K probably damaging Het
Stox1 T C 10: 62,659,569 N975S probably benign Het
Tacc3 T G 5: 33,666,684 probably null Het
Tmem55a C T 4: 14,912,463 R191C probably damaging Het
Tubb1 G A 2: 174,457,673 E383K probably benign Het
Ube3b A T 5: 114,412,444 D844V probably damaging Het
Other mutations in Cdc23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01140:Cdc23 APN 18 34636332 missense probably benign 0.01
IGL01302:Cdc23 APN 18 34634644 missense probably benign 0.19
IGL01859:Cdc23 APN 18 34651406 missense probably benign 0.01
IGL02307:Cdc23 APN 18 34641389 missense possibly damaging 0.71
IGL03081:Cdc23 APN 18 34636704 missense probably damaging 1.00
IGL03086:Cdc23 APN 18 34637186 unclassified probably benign
IGL03089:Cdc23 APN 18 34634460 missense probably damaging 1.00
IGL03249:Cdc23 APN 18 34644016 splice site probably benign
R0217:Cdc23 UTSW 18 34651665 missense unknown
R0790:Cdc23 UTSW 18 34651613 missense possibly damaging 0.94
R1593:Cdc23 UTSW 18 34636326 missense possibly damaging 0.88
R2929:Cdc23 UTSW 18 34637318 frame shift probably null
R2930:Cdc23 UTSW 18 34637318 frame shift probably null
R3963:Cdc23 UTSW 18 34646919 missense probably benign 0.01
R3983:Cdc23 UTSW 18 34637486 unclassified probably benign
R4245:Cdc23 UTSW 18 34637047 unclassified probably benign
R4417:Cdc23 UTSW 18 34637318 frame shift probably null
R4992:Cdc23 UTSW 18 34646919 missense probably benign
R5037:Cdc23 UTSW 18 34651689 missense unknown
R5071:Cdc23 UTSW 18 34651689 missense unknown
R5072:Cdc23 UTSW 18 34651689 missense unknown
R5073:Cdc23 UTSW 18 34651689 missense unknown
R5074:Cdc23 UTSW 18 34651689 missense unknown
R5081:Cdc23 UTSW 18 34651689 missense unknown
R5082:Cdc23 UTSW 18 34651689 missense unknown
R5083:Cdc23 UTSW 18 34651689 missense unknown
R5110:Cdc23 UTSW 18 34651689 missense unknown
R5111:Cdc23 UTSW 18 34651689 missense unknown
R5122:Cdc23 UTSW 18 34651689 missense unknown
R5131:Cdc23 UTSW 18 34651689 missense unknown
R5132:Cdc23 UTSW 18 34651689 missense unknown
R5166:Cdc23 UTSW 18 34651689 missense unknown
R7186:Cdc23 UTSW 18 34637122 missense probably damaging 1.00
R7359:Cdc23 UTSW 18 34641341 missense probably benign 0.40
R7732:Cdc23 UTSW 18 34636702 critical splice donor site probably null
R7832:Cdc23 UTSW 18 34647019 missense probably benign 0.11
R7915:Cdc23 UTSW 18 34647019 missense probably benign 0.11
R8031:Cdc23 UTSW 18 34651688 missense unknown
Predicted Primers PCR Primer
(F):5'- GCTCTGTAGTCTCTCTTGTTGA -3'
(R):5'- ACCAATCTAAAGACGGCTTAGAAAA -3'

Sequencing Primer
(F):5'- GTTGACCTCAATGGCATGTC -3'
(R):5'- ATGCCAGATTTCATGGCACTG -3'
Posted On2017-12-01