Incidental Mutation 'R4416:Fbxl6'
ID 500614
Institutional Source Beutler Lab
Gene Symbol Fbxl6
Ensembl Gene ENSMUSG00000022559
Gene Name F-box and leucine-rich repeat protein 6
Synonyms
MMRRC Submission 041137-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.117) question?
Stock # R4416 (G1)
Quality Score 225
Status Not validated
Chromosome 15
Chromosomal Location 76419923-76422946 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 76421924 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 205 (E205G)
Ref Sequence ENSEMBL: ENSMUSP00000023219 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023219] [ENSMUST00000023220] [ENSMUST00000230604]
AlphaFold Q9QXW0
Predicted Effect possibly damaging
Transcript: ENSMUST00000023219
AA Change: E205G

PolyPhen 2 Score 0.759 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000023219
Gene: ENSMUSG00000022559
AA Change: E205G

DomainStartEndE-ValueType
low complexity region 2 22 N/A INTRINSIC
low complexity region 58 77 N/A INTRINSIC
Pfam:F-box 104 154 3.1e-6 PFAM
Pfam:F-box-like 105 155 1.8e-13 PFAM
low complexity region 163 174 N/A INTRINSIC
SCOP:d1yrga_ 184 448 3e-9 SMART
Blast:LRR 211 236 2e-6 BLAST
Blast:LRR 347 373 6e-8 BLAST
Blast:LRR 375 405 7e-9 BLAST
Blast:LRR 432 456 7e-6 BLAST
Blast:LRR 464 488 1e-5 BLAST
Blast:LRR 489 520 7e-13 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000023220
SMART Domains Protein: ENSMUSP00000023220
Gene: ENSMUSG00000022560

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 32 43 N/A INTRINSIC
transmembrane domain 46 68 N/A INTRINSIC
transmembrane domain 81 103 N/A INTRINSIC
transmembrane domain 113 135 N/A INTRINSIC
transmembrane domain 142 164 N/A INTRINSIC
transmembrane domain 201 223 N/A INTRINSIC
Pfam:DUF1011 278 376 3e-38 PFAM
transmembrane domain 409 431 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228994
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229074
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229273
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229813
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230994
Predicted Effect probably benign
Transcript: ENSMUST00000230604
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230513
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230938
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of proteins that are characterized by an F-box motif. The encoded protein also contains leucine-rich repeats. F-box-containing proteins comprise one of the subunits of the SCF (SKP1-cullin-F-box) complex, which functions in phosphorylation-dependent ubiquitination. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933412E24Rik T A 15: 59,888,272 (GRCm39) E56V possibly damaging Het
Adam28 A G 14: 68,859,531 (GRCm39) probably null Het
Bnc1 G T 7: 81,618,708 (GRCm39) H786N probably benign Het
Cav1 T A 6: 17,339,248 (GRCm39) M100K probably benign Het
Cdk9 A G 2: 32,598,084 (GRCm39) L273P probably damaging Het
Celsr1 A G 15: 85,812,200 (GRCm39) V2065A probably damaging Het
Cyp2c54 T C 19: 40,026,703 (GRCm39) Q484R probably benign Het
Elfn1 T C 5: 139,957,949 (GRCm39) S318P possibly damaging Het
Fhip2a G T 19: 57,373,829 (GRCm39) probably null Het
Frmd6 T A 12: 70,924,023 (GRCm39) Y94N probably benign Het
Gdpd1 A T 11: 86,926,114 (GRCm39) V277D probably benign Het
Grik1 C A 16: 87,848,349 (GRCm39) V140L probably benign Het
Grpel1 A G 5: 36,628,616 (GRCm39) H175R probably damaging Het
Gtdc1 G T 2: 44,465,602 (GRCm39) probably null Het
Hivep2 A T 10: 14,004,914 (GRCm39) Q504L probably benign Het
Icos A T 1: 61,033,849 (GRCm39) I160L probably benign Het
Igsf9b G T 9: 27,234,213 (GRCm39) C442F probably damaging Het
Itga10 T C 3: 96,565,562 (GRCm39) V1062A possibly damaging Het
Lrp1b C T 2: 40,553,679 (GRCm39) V386I unknown Het
Lrp2 G T 2: 69,357,575 (GRCm39) F409L probably benign Het
Nadk T G 4: 155,672,183 (GRCm39) Y291* probably null Het
Nudt6 A T 3: 37,459,378 (GRCm39) probably null Het
Oit3 T C 10: 59,263,925 (GRCm39) Y403C probably damaging Het
Or2ag1b G A 7: 106,288,218 (GRCm39) T240I probably benign Het
Or6c70 T C 10: 129,709,826 (GRCm39) T267A probably benign Het
Or8d6 A G 9: 39,853,724 (GRCm39) H56R probably damaging Het
Pasd1 G A X: 70,983,225 (GRCm39) C399Y possibly damaging Het
Pds5b C T 5: 150,659,861 (GRCm39) P275S probably damaging Het
Pdzd7 T A 19: 45,029,019 (GRCm39) E117V probably damaging Het
Pik3ca T C 3: 32,515,679 (GRCm39) V784A probably damaging Het
Polr3e T C 7: 120,538,280 (GRCm39) probably null Het
Rab3gap2 A T 1: 185,014,544 (GRCm39) D1231V probably benign Het
Rapgef2 C A 3: 78,976,364 (GRCm39) G1481* probably null Het
Rho G A 6: 115,912,191 (GRCm39) V76I probably benign Het
Rrm1 A G 7: 102,097,008 (GRCm39) D96G probably benign Het
Slc35b2 G A 17: 45,877,355 (GRCm39) V161M probably benign Het
Spmip6 T C 4: 41,505,574 (GRCm39) T183A possibly damaging Het
Srp9 A T 1: 181,958,976 (GRCm39) M50L probably benign Het
Stox1 T C 10: 62,495,348 (GRCm39) N975S probably benign Het
Sult1d1 A G 5: 87,706,435 (GRCm39) F169S probably damaging Het
Tmem63c C G 12: 87,128,676 (GRCm39) T567R probably benign Het
Tmf1 G T 6: 97,155,949 (GRCm39) F12L probably damaging Het
Ush2a T C 1: 188,089,071 (GRCm39) I342T probably damaging Het
Veph1 A T 3: 65,968,606 (GRCm39) N712K probably damaging Het
Vti1a T G 19: 55,369,380 (GRCm39) S91A probably benign Het
Other mutations in Fbxl6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02088:Fbxl6 APN 15 76,420,106 (GRCm39) nonsense probably null
IGL02205:Fbxl6 APN 15 76,421,541 (GRCm39) missense probably benign 0.05
R0244:Fbxl6 UTSW 15 76,421,391 (GRCm39) missense probably damaging 1.00
R0449:Fbxl6 UTSW 15 76,420,155 (GRCm39) missense probably damaging 1.00
R0608:Fbxl6 UTSW 15 76,420,953 (GRCm39) missense probably benign 0.04
R0904:Fbxl6 UTSW 15 76,421,283 (GRCm39) splice site probably null
R1477:Fbxl6 UTSW 15 76,421,934 (GRCm39) missense probably benign
R1784:Fbxl6 UTSW 15 76,422,258 (GRCm39) missense probably damaging 1.00
R2109:Fbxl6 UTSW 15 76,421,173 (GRCm39) missense probably damaging 0.99
R3937:Fbxl6 UTSW 15 76,420,824 (GRCm39) nonsense probably null
R4414:Fbxl6 UTSW 15 76,421,924 (GRCm39) missense possibly damaging 0.76
R4483:Fbxl6 UTSW 15 76,422,129 (GRCm39) missense probably damaging 1.00
R4835:Fbxl6 UTSW 15 76,421,004 (GRCm39) missense probably damaging 1.00
R6175:Fbxl6 UTSW 15 76,422,633 (GRCm39) missense probably benign
R6345:Fbxl6 UTSW 15 76,420,054 (GRCm39) missense probably damaging 1.00
R6750:Fbxl6 UTSW 15 76,422,612 (GRCm39) missense probably damaging 1.00
R6800:Fbxl6 UTSW 15 76,422,898 (GRCm39) unclassified probably benign
R7485:Fbxl6 UTSW 15 76,422,113 (GRCm39) splice site probably null
R7560:Fbxl6 UTSW 15 76,422,669 (GRCm39) missense probably benign 0.06
R7726:Fbxl6 UTSW 15 76,420,086 (GRCm39) missense probably damaging 1.00
R7811:Fbxl6 UTSW 15 76,421,485 (GRCm39) splice site probably null
R8353:Fbxl6 UTSW 15 76,422,678 (GRCm39) missense probably benign 0.06
R8548:Fbxl6 UTSW 15 76,421,542 (GRCm39) missense possibly damaging 0.65
X0058:Fbxl6 UTSW 15 76,422,676 (GRCm39) missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- AGCCTATCCTATAGTCCCAGC -3'
(R):5'- TGAGGGCTCCTTGTCATCTTAC -3'

Sequencing Primer
(F):5'- ATTCTGTCCACGCCAGGC -3'
(R):5'- GGGCTCCTTGTCATCTTACTGTCTG -3'
Posted On 2017-12-01