Incidental Mutation 'R4416:Fbxl6'
ID500614
Institutional Source Beutler Lab
Gene Symbol Fbxl6
Ensembl Gene ENSMUSG00000022559
Gene NameF-box and leucine-rich repeat protein 6
Synonyms
MMRRC Submission 041137-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.105) question?
Stock #R4416 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location76535721-76538746 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 76537724 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 205 (E205G)
Ref Sequence ENSEMBL: ENSMUSP00000023219 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023219] [ENSMUST00000023220] [ENSMUST00000230604]
Predicted Effect possibly damaging
Transcript: ENSMUST00000023219
AA Change: E205G

PolyPhen 2 Score 0.759 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000023219
Gene: ENSMUSG00000022559
AA Change: E205G

DomainStartEndE-ValueType
low complexity region 2 22 N/A INTRINSIC
low complexity region 58 77 N/A INTRINSIC
Pfam:F-box 104 154 3.1e-6 PFAM
Pfam:F-box-like 105 155 1.8e-13 PFAM
low complexity region 163 174 N/A INTRINSIC
SCOP:d1yrga_ 184 448 3e-9 SMART
Blast:LRR 211 236 2e-6 BLAST
Blast:LRR 347 373 6e-8 BLAST
Blast:LRR 375 405 7e-9 BLAST
Blast:LRR 432 456 7e-6 BLAST
Blast:LRR 464 488 1e-5 BLAST
Blast:LRR 489 520 7e-13 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000023220
SMART Domains Protein: ENSMUSP00000023220
Gene: ENSMUSG00000022560

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 32 43 N/A INTRINSIC
transmembrane domain 46 68 N/A INTRINSIC
transmembrane domain 81 103 N/A INTRINSIC
transmembrane domain 113 135 N/A INTRINSIC
transmembrane domain 142 164 N/A INTRINSIC
transmembrane domain 201 223 N/A INTRINSIC
Pfam:DUF1011 278 376 3e-38 PFAM
transmembrane domain 409 431 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228994
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229074
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229273
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229813
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230513
Predicted Effect probably benign
Transcript: ENSMUST00000230604
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230938
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230994
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of proteins that are characterized by an F-box motif. The encoded protein also contains leucine-rich repeats. F-box-containing proteins comprise one of the subunits of the SCF (SKP1-cullin-F-box) complex, which functions in phosphorylation-dependent ubiquitination. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik T C 4: 41,505,574 T183A possibly damaging Het
4933412E24Rik T A 15: 60,016,423 E56V possibly damaging Het
Adam28 A G 14: 68,622,082 probably null Het
Bnc1 G T 7: 81,968,960 H786N probably benign Het
Cav1 T A 6: 17,339,249 M100K probably benign Het
Cdk9 A G 2: 32,708,072 L273P probably damaging Het
Celsr1 A G 15: 85,927,999 V2065A probably damaging Het
Cyp2c54 T C 19: 40,038,259 Q484R probably benign Het
Elfn1 T C 5: 139,972,194 S318P possibly damaging Het
Fam160b1 G T 19: 57,385,397 probably null Het
Frmd6 T A 12: 70,877,249 Y94N probably benign Het
Gdpd1 A T 11: 87,035,288 V277D probably benign Het
Gm1141 G A X: 71,939,619 C399Y possibly damaging Het
Grik1 C A 16: 88,051,461 V140L probably benign Het
Grpel1 A G 5: 36,471,272 H175R probably damaging Het
Gtdc1 G T 2: 44,575,590 probably null Het
Hivep2 A T 10: 14,129,170 Q504L probably benign Het
Icos A T 1: 60,994,690 I160L probably benign Het
Igsf9b G T 9: 27,322,917 C442F probably damaging Het
Itga10 T C 3: 96,658,246 V1062A possibly damaging Het
Lrp1b C T 2: 40,663,667 V386I unknown Het
Lrp2 G T 2: 69,527,231 F409L probably benign Het
Nadk T G 4: 155,587,726 Y291* probably null Het
Nudt6 A T 3: 37,405,229 probably null Het
Oit3 T C 10: 59,428,103 Y403C probably damaging Het
Olfr694 G A 7: 106,689,011 T240I probably benign Het
Olfr814 T C 10: 129,873,957 T267A probably benign Het
Olfr974 A G 9: 39,942,428 H56R probably damaging Het
Pds5b C T 5: 150,736,396 P275S probably damaging Het
Pdzd7 T A 19: 45,040,580 E117V probably damaging Het
Pik3ca T C 3: 32,461,530 V784A probably damaging Het
Polr3e T C 7: 120,939,057 probably null Het
Rab3gap2 A T 1: 185,282,347 D1231V probably benign Het
Rapgef2 C A 3: 79,069,057 G1481* probably null Het
Rho G A 6: 115,935,230 V76I probably benign Het
Rrm1 A G 7: 102,447,801 D96G probably benign Het
Slc35b2 G A 17: 45,566,429 V161M probably benign Het
Srp9 A T 1: 182,131,411 M50L probably benign Het
Stox1 T C 10: 62,659,569 N975S probably benign Het
Sult1d1 A G 5: 87,558,576 F169S probably damaging Het
Tmem63c C G 12: 87,081,902 T567R probably benign Het
Tmf1 G T 6: 97,178,988 F12L probably damaging Het
Ush2a T C 1: 188,356,874 I342T probably damaging Het
Veph1 A T 3: 66,061,185 N712K probably damaging Het
Vti1a T G 19: 55,380,948 S91A probably benign Het
Other mutations in Fbxl6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02088:Fbxl6 APN 15 76535906 nonsense probably null
IGL02205:Fbxl6 APN 15 76537341 missense probably benign 0.05
R0244:Fbxl6 UTSW 15 76537191 missense probably damaging 1.00
R0449:Fbxl6 UTSW 15 76535955 missense probably damaging 1.00
R0608:Fbxl6 UTSW 15 76536753 missense probably benign 0.04
R0904:Fbxl6 UTSW 15 76537083 unclassified probably null
R1477:Fbxl6 UTSW 15 76537734 missense probably benign
R1784:Fbxl6 UTSW 15 76538058 missense probably damaging 1.00
R2109:Fbxl6 UTSW 15 76536973 missense probably damaging 0.99
R3937:Fbxl6 UTSW 15 76536624 nonsense probably null
R4414:Fbxl6 UTSW 15 76537724 missense possibly damaging 0.76
R4483:Fbxl6 UTSW 15 76537929 missense probably damaging 1.00
R4835:Fbxl6 UTSW 15 76536804 missense probably damaging 1.00
R6175:Fbxl6 UTSW 15 76538433 missense probably benign
R6345:Fbxl6 UTSW 15 76535854 missense probably damaging 1.00
R6750:Fbxl6 UTSW 15 76538412 missense probably damaging 1.00
R6800:Fbxl6 UTSW 15 76538698 unclassified probably benign
R7485:Fbxl6 UTSW 15 76537913 splice site probably null
R7560:Fbxl6 UTSW 15 76538469 missense probably benign 0.06
R7726:Fbxl6 UTSW 15 76535886 missense probably damaging 1.00
X0058:Fbxl6 UTSW 15 76538476 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- AGCCTATCCTATAGTCCCAGC -3'
(R):5'- TGAGGGCTCCTTGTCATCTTAC -3'

Sequencing Primer
(F):5'- ATTCTGTCCACGCCAGGC -3'
(R):5'- GGGCTCCTTGTCATCTTACTGTCTG -3'
Posted On2017-12-01