Incidental Mutation 'R4419:Myo3b'
ID500617
Institutional Source Beutler Lab
Gene Symbol Myo3b
Ensembl Gene ENSMUSG00000042064
Gene Namemyosin IIIB
SynonymsA430065P19Rik
MMRRC Submission 041140-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4419 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location70039126-70429198 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 70096362 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 51 (D51G)
Ref Sequence ENSEMBL: ENSMUSP00000107862 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060208] [ENSMUST00000112241] [ENSMUST00000112243]
Predicted Effect probably damaging
Transcript: ENSMUST00000060208
AA Change: D79G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000055362
Gene: ENSMUSG00000042064
AA Change: D79G

DomainStartEndE-ValueType
S_TKc 43 309 2.24e-85 SMART
MYSc 353 1075 6.61e-260 SMART
IQ 1075 1097 9.51e1 SMART
IQ 1102 1124 1.73e-5 SMART
low complexity region 1319 1324 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112241
SMART Domains Protein: ENSMUSP00000107860
Gene: ENSMUSG00000042064

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 1 187 3.7e-30 PFAM
Pfam:Pkinase 1 188 8.3e-45 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000112243
AA Change: D51G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107862
Gene: ENSMUSG00000042064
AA Change: D51G

DomainStartEndE-ValueType
S_TKc 15 281 2.24e-85 SMART
MYSc 325 1047 6.61e-260 SMART
IQ 1047 1069 9.51e1 SMART
IQ 1074 1096 1.73e-5 SMART
low complexity region 1291 1296 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the class III myosins. Myosins are ATPases, activated by actin, that move along actin filaments in the cell. This class of myosins are characterized by an amino-terminal kinase domain and shown to be present in photoreceptors. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2014]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Amdhd2 G A 17: 24,158,678 P126L probably benign Het
Arfip2 T C 7: 105,639,063 T44A probably damaging Het
B4galt1 A G 4: 40,853,537 V90A probably benign Het
Bad C A 19: 6,950,685 A115E probably benign Het
Bicc1 A G 10: 70,946,974 L521P possibly damaging Het
Caskin1 T C 17: 24,504,709 S824P probably damaging Het
Cblb T A 16: 52,047,258 D76E possibly damaging Het
Celsr3 G T 9: 108,843,244 A2572S possibly damaging Het
Csmd3 T C 15: 47,704,311 Q2152R probably damaging Het
D2hgdh T A 1: 93,829,813 V150E probably damaging Het
Ddn C A 15: 98,805,611 W600L probably benign Het
Dicer1 A T 12: 104,705,114 Y966N probably damaging Het
Dsp T A 13: 38,195,132 I1352N probably damaging Het
Duox1 G A 2: 122,327,126 A578T probably benign Het
Dysf T C 6: 84,207,242 probably null Het
Elmo2 T C 2: 165,311,755 probably null Het
Heg1 A T 16: 33,727,435 E864V probably benign Het
Hoxb9 T C 11: 96,271,981 V147A probably benign Het
Kdm1b C T 13: 47,063,077 R308W probably damaging Het
Ky G A 9: 102,542,710 V639I probably damaging Het
Med16 G A 10: 79,898,382 A566V probably benign Het
Mettl17 G T 14: 51,887,272 G167C possibly damaging Het
Mgat4b T C 11: 50,232,986 F318L probably damaging Het
Mug2 C A 6: 122,079,630 A1178D probably damaging Het
Naip2 T C 13: 100,160,625 N968D probably benign Het
Nbea T C 3: 56,009,600 H820R probably damaging Het
Nqo1 C T 8: 107,392,117 probably null Het
Olfr1328 A T 4: 118,934,389 I153N possibly damaging Het
Olfr780 T C 10: 129,321,815 F64S possibly damaging Het
Olfr916 C T 9: 38,658,069 V108I probably benign Het
Ppargc1a T C 5: 51,494,702 D218G probably damaging Het
Rras A G 7: 45,020,579 D145G probably damaging Het
Scn3a C A 2: 65,466,960 G1452C probably damaging Het
Slc22a2 C A 17: 12,612,586 S421* probably null Het
Slc39a10 A G 1: 46,810,066 F797L probably benign Het
Spta1 T A 1: 174,247,424 Y2405* probably null Het
Ss18 A G 18: 14,633,605 Y359H unknown Het
St14 C T 9: 31,096,928 C537Y probably damaging Het
Tmem252 T A 19: 24,677,546 Y96N probably damaging Het
Trafd1 T C 5: 121,373,333 D474G probably benign Het
Trmt1l A G 1: 151,440,808 I20M probably damaging Het
Ulk1 C T 5: 110,789,357 R691Q probably benign Het
Vmn1r43 A G 6: 89,869,647 S286P probably benign Het
Other mutations in Myo3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00736:Myo3b APN 2 70105645 splice site probably benign
IGL00959:Myo3b APN 2 70314292 missense probably damaging 1.00
IGL01069:Myo3b APN 2 70245391 missense probably benign 0.22
IGL01116:Myo3b APN 2 70289386 missense probably damaging 1.00
IGL02097:Myo3b APN 2 70238829 missense probably damaging 1.00
IGL02220:Myo3b APN 2 70289579 splice site probably benign
IGL02553:Myo3b APN 2 70095224 missense probably benign 0.00
IGL02557:Myo3b APN 2 70255319 missense probably benign 0.16
IGL02648:Myo3b APN 2 70105372 splice site probably benign
IGL02902:Myo3b APN 2 70289401 missense probably benign 0.36
IGL02981:Myo3b APN 2 70108625 missense probably damaging 1.00
IGL03030:Myo3b APN 2 70426816 splice site probably benign
IGL03031:Myo3b APN 2 70255377 missense possibly damaging 0.64
IGL03068:Myo3b APN 2 70426816 splice site probably benign
IGL03078:Myo3b APN 2 70286991 missense probably damaging 1.00
IGL03224:Myo3b APN 2 70349939 missense probably benign
IGL03329:Myo3b APN 2 70254459 missense probably damaging 1.00
R0079:Myo3b UTSW 2 70095158 missense possibly damaging 0.58
R0226:Myo3b UTSW 2 70217166 missense probably benign 0.00
R0238:Myo3b UTSW 2 70105425 missense probably benign 0.00
R0238:Myo3b UTSW 2 70105425 missense probably benign 0.00
R0239:Myo3b UTSW 2 70105425 missense probably benign 0.00
R0239:Myo3b UTSW 2 70105425 missense probably benign 0.00
R0313:Myo3b UTSW 2 70348959 nonsense probably null
R0331:Myo3b UTSW 2 70095261 missense probably damaging 1.00
R0371:Myo3b UTSW 2 70252960 splice site probably benign
R0442:Myo3b UTSW 2 70238961 critical splice donor site probably null
R0964:Myo3b UTSW 2 70426849 missense probably damaging 1.00
R1217:Myo3b UTSW 2 70330880 missense probably benign 0.02
R1429:Myo3b UTSW 2 70253007 missense probably damaging 0.97
R1460:Myo3b UTSW 2 70232454 missense probably benign 0.31
R1617:Myo3b UTSW 2 70281218 missense probably benign 0.00
R1628:Myo3b UTSW 2 70286962 missense probably benign 0.01
R1708:Myo3b UTSW 2 70245385 nonsense probably null
R1940:Myo3b UTSW 2 70258075 missense probably benign 0.01
R2407:Myo3b UTSW 2 70255253 missense probably damaging 1.00
R3081:Myo3b UTSW 2 70256583 splice site probably benign
R3687:Myo3b UTSW 2 70245314 missense probably benign
R3745:Myo3b UTSW 2 70234485 splice site probably benign
R4011:Myo3b UTSW 2 70096376 missense probably benign 0.15
R4074:Myo3b UTSW 2 70289464 missense probably damaging 1.00
R4496:Myo3b UTSW 2 70254404 missense probably benign
R4539:Myo3b UTSW 2 70039147 start codon destroyed probably null 0.00
R4643:Myo3b UTSW 2 70238842 missense possibly damaging 0.49
R4657:Myo3b UTSW 2 70238899 missense possibly damaging 0.95
R4807:Myo3b UTSW 2 70105712 missense probably damaging 1.00
R4849:Myo3b UTSW 2 70244909 missense probably damaging 0.98
R4997:Myo3b UTSW 2 70258083 missense possibly damaging 0.49
R5008:Myo3b UTSW 2 70258068 missense probably damaging 0.99
R5070:Myo3b UTSW 2 70253112 missense probably damaging 1.00
R5072:Myo3b UTSW 2 70095249 missense possibly damaging 0.96
R5082:Myo3b UTSW 2 70258030 missense probably benign 0.01
R5103:Myo3b UTSW 2 70096403 missense probably benign 0.08
R5109:Myo3b UTSW 2 70095293 missense possibly damaging 0.66
R5304:Myo3b UTSW 2 70426888 missense probably damaging 0.97
R5396:Myo3b UTSW 2 70126985 missense probably damaging 0.99
R5400:Myo3b UTSW 2 70105380 missense probably damaging 1.00
R5468:Myo3b UTSW 2 70234441 missense probably benign 0.00
R5620:Myo3b UTSW 2 70238910 missense probably benign 0.04
R5646:Myo3b UTSW 2 70314430 missense probably damaging 0.97
R5729:Myo3b UTSW 2 70105739 missense probably damaging 1.00
R5943:Myo3b UTSW 2 70286941 missense probably benign 0.03
R5971:Myo3b UTSW 2 70238899 missense possibly damaging 0.95
R6091:Myo3b UTSW 2 70238769 missense probably benign 0.00
R6138:Myo3b UTSW 2 70238899 missense possibly damaging 0.95
R6164:Myo3b UTSW 2 70245410 critical splice donor site probably null
R6177:Myo3b UTSW 2 70313363 missense probably benign 0.00
R6421:Myo3b UTSW 2 70313356 missense probably benign 0.02
R6478:Myo3b UTSW 2 70348960 missense probably benign
R6606:Myo3b UTSW 2 70232485 missense possibly damaging 0.94
R6752:Myo3b UTSW 2 70289512 missense probably damaging 1.00
R6982:Myo3b UTSW 2 70426065 missense probably benign 0.02
R6997:Myo3b UTSW 2 70126985 missense probably damaging 0.99
R7032:Myo3b UTSW 2 70095264 missense probably damaging 0.98
R7038:Myo3b UTSW 2 70095208 missense probably benign 0.00
R7062:Myo3b UTSW 2 70217157 missense probably benign 0.00
R7537:Myo3b UTSW 2 70217169 missense probably benign 0.01
R7861:Myo3b UTSW 2 70108688 missense probably damaging 1.00
U15987:Myo3b UTSW 2 70238899 missense possibly damaging 0.95
X0025:Myo3b UTSW 2 70232403 missense probably benign 0.00
X0065:Myo3b UTSW 2 70257969 missense probably damaging 1.00
Z1177:Myo3b UTSW 2 70096361 missense probably damaging 1.00
Z1177:Myo3b UTSW 2 70258027 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGAGTCCAGTGTAGTGGTGC -3'
(R):5'- GAACGGACTTCTCCAACCTG -3'

Sequencing Primer
(F):5'- GCACACTTGTAATTCAAACTCTTGGG -3'
(R):5'- ACCTGCAAACGCGCTTC -3'
Posted On2017-12-01