Incidental Mutation 'R0543:Pdzd3'
ID 50062
Institutional Source Beutler Lab
Gene Symbol Pdzd3
Ensembl Gene ENSMUSG00000032105
Gene Name PDZ domain containing 3
Synonyms sodium-phosphate cotransporter IIa C-terminal-associated protein 2, Pdzk2, NaPi-Cap2
MMRRC Submission 038735-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R0543 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 44247307-44251471 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 44248934 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 324 (H324Q)
Ref Sequence ENSEMBL: ENSMUSP00000034618 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034618] [ENSMUST00000034621] [ENSMUST00000092426] [ENSMUST00000168499] [ENSMUST00000169651] [ENSMUST00000213891] [ENSMUST00000215554] [ENSMUST00000215711] [ENSMUST00000216632] [ENSMUST00000217221] [ENSMUST00000217510]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000034618
AA Change: H324Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000034618
Gene: ENSMUSG00000032105
AA Change: H324Q

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
PDZ 58 130 2.04e-15 SMART
PDZ 165 235 2.93e-7 SMART
PDZ 271 346 2.47e-14 SMART
PDZ 403 475 1.4e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000034621
SMART Domains Protein: ENSMUSP00000034621
Gene: ENSMUSG00000032109

DomainStartEndE-ValueType
Pfam:NACHT 160 325 1.1e-22 PFAM
low complexity region 543 556 N/A INTRINSIC
LRR 695 722 1.66e2 SMART
LRR 749 776 3.59e1 SMART
LRR 778 805 6.23e-2 SMART
LRR 806 833 1.13e0 SMART
LRR 834 861 1.99e1 SMART
LRR 862 885 8.11e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000092426
SMART Domains Protein: ENSMUSP00000090082
Gene: ENSMUSG00000070306

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
coiled coil region 26 148 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168499
SMART Domains Protein: ENSMUSP00000127531
Gene: ENSMUSG00000032109

DomainStartEndE-ValueType
Pfam:NACHT 160 325 1.3e-23 PFAM
low complexity region 543 556 N/A INTRINSIC
LRR 695 722 1.66e2 SMART
LRR 749 776 3.59e1 SMART
LRR 778 805 6.23e-2 SMART
LRR 806 833 1.13e0 SMART
LRR 834 861 1.99e1 SMART
LRR 862 885 8.11e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169651
SMART Domains Protein: ENSMUSP00000126555
Gene: ENSMUSG00000032109

DomainStartEndE-ValueType
Pfam:NACHT 160 325 1.3e-23 PFAM
low complexity region 543 556 N/A INTRINSIC
LRR 695 722 1.66e2 SMART
LRR 749 776 3.59e1 SMART
LRR 778 805 6.23e-2 SMART
LRR 806 833 1.13e0 SMART
LRR 834 861 1.99e1 SMART
LRR 862 885 8.11e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213186
Predicted Effect probably benign
Transcript: ENSMUST00000213891
Predicted Effect probably benign
Transcript: ENSMUST00000215554
Predicted Effect probably benign
Transcript: ENSMUST00000215711
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216047
Predicted Effect probably benign
Transcript: ENSMUST00000216632
Predicted Effect probably benign
Transcript: ENSMUST00000217221
Predicted Effect probably benign
Transcript: ENSMUST00000217510
Meta Mutation Damage Score 0.5892 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.3%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Guanylyl cyclase C (GCC, or GUCY2C; MIM 601330) produces cGMP following the binding of either endogenous ligands or heat-stable enterotoxins secreted by E. coli and other enteric bacteria. Activation of GCC initiates a signaling cascade that leads to phosphorylation of the cystic fibrosis transmembrane conductance regulator (CFTR; MIM 602421), followed by a net efflux of ions and water into the intestinal lumen. IKEPP is a regulatory protein that associates with GCC and regulates the amount of cGMP produced following receptor stimulation (Scott et al., 2002 [PubMed 11950846]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1500015O10Rik C A 1: 43,742,289 N110K possibly damaging Het
4930444G20Rik T C 10: 22,066,924 S386G possibly damaging Het
4932438A13Rik G A 3: 36,996,458 S2981N probably benign Het
Alox5 T A 6: 116,454,317 probably null Het
Apol9b A G 15: 77,735,640 N212S probably damaging Het
Ash1l T A 3: 89,063,778 probably null Het
Ccdc180 A T 4: 45,900,041 K200* probably null Het
Ccser2 A T 14: 36,940,192 M345K probably benign Het
Cdcp2 A T 4: 107,097,676 probably null Het
Clca3a1 T C 3: 144,748,394 probably benign Het
Cntn3 G A 6: 102,269,090 probably benign Het
Col28a1 T A 6: 8,075,326 probably benign Het
Dock2 A G 11: 34,294,325 F1035S probably damaging Het
Dsg1a A T 18: 20,340,863 S998C probably damaging Het
Enox1 T C 14: 77,506,959 probably benign Het
Fgfr3 A G 5: 33,729,710 M1V probably null Het
Fuca2 T A 10: 13,503,126 Y5N probably damaging Het
Git2 G T 5: 114,745,531 H42Q probably damaging Het
Gm7964 G A 7: 83,756,394 noncoding transcript Het
Hars2 G A 18: 36,789,424 E337K probably damaging Het
Hells A G 19: 38,967,750 R797G probably benign Het
Hnf1a G A 5: 114,950,744 S571L probably benign Het
Hoxa5 T C 6: 52,204,340 Y4C probably damaging Het
Inpp4a G A 1: 37,369,492 probably benign Het
Ints6 T C 14: 62,696,611 I816V probably damaging Het
Itpr1 T C 6: 108,515,748 probably benign Het
Kcnt2 C A 1: 140,609,614 P1037T probably damaging Het
Lyg2 T A 1: 37,911,107 M47L possibly damaging Het
Macf1 G T 4: 123,376,378 A4648D probably damaging Het
Mcf2l T C 8: 12,996,728 probably null Het
Mcm9 C T 10: 53,541,598 R3H probably damaging Het
Met T A 6: 17,491,970 Y244N probably damaging Het
Mettl14 A T 3: 123,374,762 C210S possibly damaging Het
Mrgpra4 T C 7: 47,981,310 Y181C probably benign Het
Mtch2 T C 2: 90,849,682 V86A possibly damaging Het
Mttp A T 3: 138,111,696 I446N possibly damaging Het
Muc4 T A 16: 32,756,746 S2207T unknown Het
Muc5b A G 7: 141,851,785 T944A unknown Het
Myo15 A T 11: 60,479,051 H879L probably benign Het
Nkiras2 G A 11: 100,624,192 probably benign Het
Nostrin T G 2: 69,189,131 *507E probably null Het
Nup205 T C 6: 35,198,969 V589A probably benign Het
Olfr1141 C A 2: 87,753,650 L114F probably damaging Het
Olfr1444 G T 19: 12,861,888 V38F probably benign Het
Olfr530 A G 7: 140,373,394 I72T probably benign Het
Oxct2b T A 4: 123,116,989 M234K possibly damaging Het
Park2 G A 17: 11,067,179 D20N probably damaging Het
Pcdha1 A T 18: 37,185,068 I945F probably damaging Het
Pik3ca G A 3: 32,450,261 probably null Het
Pkhd1l1 A G 15: 44,523,491 probably null Het
Plscr1 A T 9: 92,258,046 probably null Het
Psd T C 19: 46,319,517 E684G possibly damaging Het
Rab11fip3 T C 17: 25,994,225 E870G probably damaging Het
Rpl22l1 C A 3: 28,807,274 Y103* probably null Het
Slc38a4 A T 15: 97,016,839 N44K possibly damaging Het
Slco6c1 T A 1: 97,127,898 I93F probably damaging Het
Ssfa2 T A 2: 79,644,506 S270T possibly damaging Het
Strip1 G A 3: 107,626,775 T181M possibly damaging Het
Stxbp5l G A 16: 37,208,096 A535V probably damaging Het
Tg A T 15: 66,729,597 Q152L probably benign Het
Thada T C 17: 84,423,163 T1036A probably damaging Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Tns1 T A 1: 73,952,697 T941S probably benign Het
Tppp3 T C 8: 105,468,208 D97G probably benign Het
Trp53bp1 C A 2: 121,251,868 A317S probably null Het
Trpm7 T C 2: 126,848,529 I210V probably damaging Het
Ubr1 A G 2: 120,881,093 L1440P probably damaging Het
Utp18 A T 11: 93,875,835 Y317N probably damaging Het
Zdhhc5 T A 2: 84,692,480 probably benign Het
Zfp719 A G 7: 43,589,253 probably null Het
Other mutations in Pdzd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00861:Pdzd3 APN 9 44249636 missense possibly damaging 0.84
IGL01639:Pdzd3 APN 9 44248679 missense probably benign 0.41
IGL02210:Pdzd3 APN 9 44248317 missense probably benign
IGL02502:Pdzd3 APN 9 44249651 missense probably benign
IGL03082:Pdzd3 APN 9 44250786 missense possibly damaging 0.65
R1180:Pdzd3 UTSW 9 44249246 missense probably benign 0.38
R1919:Pdzd3 UTSW 9 44250303 missense possibly damaging 0.83
R4019:Pdzd3 UTSW 9 44250820 splice site probably null
R4020:Pdzd3 UTSW 9 44250820 splice site probably null
R4296:Pdzd3 UTSW 9 44248861 missense probably benign 0.01
R4430:Pdzd3 UTSW 9 44249744 missense probably benign
R4433:Pdzd3 UTSW 9 44247988 makesense probably null
R4567:Pdzd3 UTSW 9 44249026 missense possibly damaging 0.90
R4942:Pdzd3 UTSW 9 44248618 nonsense probably null
R5436:Pdzd3 UTSW 9 44248355 missense possibly damaging 0.79
R6320:Pdzd3 UTSW 9 44248683 missense probably benign 0.00
R6688:Pdzd3 UTSW 9 44248230 critical splice donor site probably null
R7625:Pdzd3 UTSW 9 44250297 missense probably damaging 1.00
R8142:Pdzd3 UTSW 9 44250781 critical splice donor site probably null
R8531:Pdzd3 UTSW 9 44248373 missense probably damaging 1.00
R8917:Pdzd3 UTSW 9 44248844 unclassified probably benign
R9147:Pdzd3 UTSW 9 44249379 missense probably damaging 1.00
R9148:Pdzd3 UTSW 9 44249379 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCAGAGTCTGAATCCATAGCCACC -3'
(R):5'- TTCTCAGCATCCATGAGCGATGCC -3'

Sequencing Primer
(F):5'- TTCAACCGGAAGATCCTTGG -3'
(R):5'- AGCTTTCCATGCACTGTAGAG -3'
Posted On 2013-06-12