Incidental Mutation 'R4353:Meis2'
ID500621
Institutional Source Beutler Lab
Gene Symbol Meis2
Ensembl Gene ENSMUSG00000027210
Gene NameMeis homeobox 2
SynonymsStra10, Meis2, A430109D20Rik, Mrg1
MMRRC Submission 040866-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.884) question?
Stock #R4353 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location115863064-116065839 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 116059563 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 146 (M146T)
Ref Sequence ENSEMBL: ENSMUSP00000106531 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028639] [ENSMUST00000074285] [ENSMUST00000102538] [ENSMUST00000110906] [ENSMUST00000110907] [ENSMUST00000110908]
Predicted Effect probably damaging
Transcript: ENSMUST00000028639
AA Change: M147T

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000028639
Gene: ENSMUSG00000027210
AA Change: M147T

DomainStartEndE-ValueType
Pfam:Meis_PKNOX_N 110 194 3.8e-48 PFAM
HOX 276 341 4.27e-12 SMART
low complexity region 395 402 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000074285
AA Change: M146T

PolyPhen 2 Score 0.803 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000073898
Gene: ENSMUSG00000027210
AA Change: M146T

DomainStartEndE-ValueType
HOX 275 340 4.27e-12 SMART
low complexity region 375 388 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102538
AA Change: M147T

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000099597
Gene: ENSMUSG00000027210
AA Change: M147T

DomainStartEndE-ValueType
HOX 276 341 4.27e-12 SMART
low complexity region 388 395 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110906
AA Change: M146T

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000106531
Gene: ENSMUSG00000027210
AA Change: M146T

DomainStartEndE-ValueType
HOX 275 340 4.27e-12 SMART
low complexity region 382 395 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110907
AA Change: M147T

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000106532
Gene: ENSMUSG00000027210
AA Change: M147T

DomainStartEndE-ValueType
HOX 276 341 4.27e-12 SMART
low complexity region 383 396 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110908
AA Change: M147T

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000106533
Gene: ENSMUSG00000027210
AA Change: M147T

DomainStartEndE-ValueType
HOX 276 341 4.27e-12 SMART
low complexity region 376 389 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133990
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134314
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138526
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140461
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a homeobox protein belonging to the TALE ('three amino acid loop extension') family of homeodomain-containing proteins. TALE homeobox proteins are highly conserved transcriptional regulators and several members have been shown to be essential contributors to developmental programs. In mice, a knock-out of this gene leads to lethality at embryonic day 14, accompanied with hemorrhaging. Embryos lacking this gene show defects in tissues derived from the neural crest, suggesting a critical role of this gene during cranial and cardiac neural crest cell development. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a null allele display early fetal lethality with hemorrhaging, persistent truncus arteriosis, absence of cardic valves and defects in other neural crest cell derived tissues. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933425L06Rik T C 13: 105,118,745 Y445H probably benign Het
5730559C18Rik C T 1: 136,226,208 V180I probably damaging Het
A2ml1 C T 6: 128,580,386 A115T probably benign Het
Alpk2 C T 18: 65,291,452 R1888H possibly damaging Het
Arhgap33 C A 7: 30,524,136 V823L possibly damaging Het
Atp2b2 T C 6: 113,765,784 I736V probably benign Het
Atp8a1 T C 5: 67,769,108 T260A probably damaging Het
B4galnt3 T C 6: 120,215,476 E433G possibly damaging Het
Bzw2 A T 12: 36,123,979 F99I probably damaging Het
Cdh20 A G 1: 104,979,089 D547G probably damaging Het
Col27a1 G T 4: 63,225,631 A519S probably benign Het
Coq6 G A 12: 84,368,149 G110D probably damaging Het
Cpb1 T C 3: 20,262,544 T281A probably benign Het
Cttnbp2 T C 6: 18,514,704 D11G probably benign Het
Cyp2c37 A G 19: 40,000,545 Y316C possibly damaging Het
Dcdc2a T A 13: 25,056,491 I74N probably damaging Het
Dhx9 A G 1: 153,471,789 L391P probably damaging Het
Dsc2 G T 18: 20,050,068 L98I probably damaging Het
Dthd1 T A 5: 62,842,867 S511T probably benign Het
Dusp2 A G 2: 127,337,336 T204A probably damaging Het
Elovl5 T C 9: 77,960,917 V37A probably benign Het
Etv1 A G 12: 38,857,106 E369G probably damaging Het
Gem G A 4: 11,705,939 R9H probably damaging Het
Heg1 A G 16: 33,710,477 T108A probably benign Het
Iqgap2 C T 13: 95,671,396 V788M probably damaging Het
Kyat3 T C 3: 142,731,293 probably null Het
Llgl1 C T 11: 60,709,568 P581L probably benign Het
Mecom C A 3: 29,966,738 V452L possibly damaging Het
Nrp2 A G 1: 62,738,417 D127G probably damaging Het
Nup214 T C 2: 31,977,917 probably null Het
Olfr93 T A 17: 37,151,337 I58F probably damaging Het
Pabpc4 C T 4: 123,290,267 T191I probably damaging Het
Pcnx2 T C 8: 125,762,851 H1668R probably damaging Het
Poln C T 5: 34,129,452 C124Y probably benign Het
Ppp2r2a T A 14: 67,028,937 I92L probably damaging Het
Prpmp5 T G 6: 132,313,661 Y25S unknown Het
Ptch1 C T 13: 63,534,329 R537H probably damaging Het
Rnf130 T C 11: 50,087,440 V276A possibly damaging Het
Rnf31 AAC A 14: 55,601,098 probably null Het
Rnf38 A T 4: 44,149,100 N82K possibly damaging Het
Scn7a T A 2: 66,676,436 M1370L probably benign Het
Sema4b C A 7: 80,215,651 L125I probably damaging Het
Slc12a7 C T 13: 73,790,734 T210I possibly damaging Het
Sox8 A C 17: 25,567,335 *465G probably null Het
Spg11 G T 2: 122,113,194 T159K possibly damaging Het
Stk36 A G 1: 74,632,807 R889G possibly damaging Het
Tmbim7 A G 5: 3,661,796 S14G probably benign Het
Usp16 A G 16: 87,470,354 N211D probably damaging Het
Vmn1r6 C T 6: 57,002,692 A113V possibly damaging Het
Zc3h14 A G 12: 98,763,960 N92D possibly damaging Het
Zfp638 T C 6: 83,984,059 S1206P probably damaging Het
Other mutations in Meis2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00590:Meis2 APN 2 115868793 missense probably damaging 1.00
IGL00708:Meis2 APN 2 115864244 missense probably benign 0.11
IGL01095:Meis2 APN 2 115864424 missense probably benign
IGL02199:Meis2 APN 2 116000256 missense probably benign 0.01
IGL02562:Meis2 APN 2 116049146 missense probably damaging 1.00
IGL02902:Meis2 APN 2 116063323 missense probably damaging 0.96
IGL03183:Meis2 APN 2 116059521 missense probably damaging 0.98
IGL03205:Meis2 APN 2 115864250 missense probably benign 0.08
P4748:Meis2 UTSW 2 115864480 missense probably benign 0.03
R0369:Meis2 UTSW 2 116063416 missense possibly damaging 0.82
R0410:Meis2 UTSW 2 115864228 makesense probably null
R1465:Meis2 UTSW 2 116058670 missense probably benign 0.03
R1465:Meis2 UTSW 2 116058670 missense probably benign 0.03
R1548:Meis2 UTSW 2 116058702 missense probably damaging 0.97
R1593:Meis2 UTSW 2 116000264 missense probably damaging 1.00
R3835:Meis2 UTSW 2 115921747 missense probably damaging 1.00
R4756:Meis2 UTSW 2 116000205 missense probably damaging 1.00
R4936:Meis2 UTSW 2 115864412 missense probably benign
R5841:Meis2 UTSW 2 116058664 missense probably benign
R5967:Meis2 UTSW 2 115864309 missense probably benign 0.04
R6661:Meis2 UTSW 2 115864270 missense probably damaging 0.97
R6781:Meis2 UTSW 2 116049155 missense probably benign 0.20
R7239:Meis2 UTSW 2 116059003 intron probably null
R7606:Meis2 UTSW 2 116063320 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- AGCCCCTGGGTTAAGAAGTC -3'
(R):5'- CCCACTACTGTAGCCAATGAGG -3'

Sequencing Primer
(F):5'- CCCCTGGGTTAAGAAGTCTATAAAG -3'
(R):5'- GGCAGAGATGATCAGTAATAATTTGG -3'
Posted On2017-12-01