Incidental Mutation 'R4353:Usp16'
ID500622
Institutional Source Beutler Lab
Gene Symbol Usp16
Ensembl Gene ENSMUSG00000025616
Gene Nameubiquitin specific peptidase 16
Synonyms2810483I07Rik, 1200004E02Rik, UBP-M, 6330514E22Rik
MMRRC Submission 040866-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4353 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location87454703-87483517 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 87470354 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 211 (N211D)
Ref Sequence ENSEMBL: ENSMUSP00000116323 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026710] [ENSMUST00000119504] [ENSMUST00000144759]
Predicted Effect probably damaging
Transcript: ENSMUST00000026710
AA Change: N212D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000026710
Gene: ENSMUSG00000025616
AA Change: N212D

DomainStartEndE-ValueType
Pfam:zf-UBP 48 127 2.5e-23 PFAM
coiled coil region 149 182 N/A INTRINSIC
Pfam:UCH 194 821 2e-54 PFAM
Pfam:UCH_1 195 800 3.8e-15 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000119504
AA Change: N211D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114058
Gene: ENSMUSG00000025616
AA Change: N211D

DomainStartEndE-ValueType
Pfam:zf-UBP 48 127 6.9e-24 PFAM
coiled coil region 149 181 N/A INTRINSIC
Pfam:UCH 193 732 1.2e-36 PFAM
Pfam:UCH_1 194 737 2.5e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131206
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135399
Predicted Effect probably damaging
Transcript: ENSMUST00000144759
AA Change: N211D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116323
Gene: ENSMUSG00000025616
AA Change: N211D

DomainStartEndE-ValueType
Pfam:zf-UBP 48 127 2e-24 PFAM
coiled coil region 149 181 N/A INTRINSIC
Pfam:UCH 193 330 2.4e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146386
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177538
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a deubiquitinating enzyme that is phosphorylated at the onset of mitosis and then dephosphorylated at the metaphase/anaphase transition. It can deubiquitinate H2A, one of two major ubiquitinated proteins of chromatin, in vitro and a mutant form of the protein was shown to block cell division. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E6. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933425L06Rik T C 13: 105,118,745 Y445H probably benign Het
5730559C18Rik C T 1: 136,226,208 V180I probably damaging Het
A2ml1 C T 6: 128,580,386 A115T probably benign Het
Alpk2 C T 18: 65,291,452 R1888H possibly damaging Het
Arhgap33 C A 7: 30,524,136 V823L possibly damaging Het
Atp2b2 T C 6: 113,765,784 I736V probably benign Het
Atp8a1 T C 5: 67,769,108 T260A probably damaging Het
B4galnt3 T C 6: 120,215,476 E433G possibly damaging Het
Bzw2 A T 12: 36,123,979 F99I probably damaging Het
Cdh20 A G 1: 104,979,089 D547G probably damaging Het
Col27a1 G T 4: 63,225,631 A519S probably benign Het
Coq6 G A 12: 84,368,149 G110D probably damaging Het
Cpb1 T C 3: 20,262,544 T281A probably benign Het
Cttnbp2 T C 6: 18,514,704 D11G probably benign Het
Cyp2c37 A G 19: 40,000,545 Y316C possibly damaging Het
Dcdc2a T A 13: 25,056,491 I74N probably damaging Het
Dhx9 A G 1: 153,471,789 L391P probably damaging Het
Dsc2 G T 18: 20,050,068 L98I probably damaging Het
Dthd1 T A 5: 62,842,867 S511T probably benign Het
Dusp2 A G 2: 127,337,336 T204A probably damaging Het
Elovl5 T C 9: 77,960,917 V37A probably benign Het
Etv1 A G 12: 38,857,106 E369G probably damaging Het
Gem G A 4: 11,705,939 R9H probably damaging Het
Heg1 A G 16: 33,710,477 T108A probably benign Het
Iqgap2 C T 13: 95,671,396 V788M probably damaging Het
Kyat3 T C 3: 142,731,293 probably null Het
Llgl1 C T 11: 60,709,568 P581L probably benign Het
Mecom C A 3: 29,966,738 V452L possibly damaging Het
Meis2 A G 2: 116,059,563 M146T probably damaging Het
Nrp2 A G 1: 62,738,417 D127G probably damaging Het
Nup214 T C 2: 31,977,917 probably null Het
Olfr93 T A 17: 37,151,337 I58F probably damaging Het
Pabpc4 C T 4: 123,290,267 T191I probably damaging Het
Pcnx2 T C 8: 125,762,851 H1668R probably damaging Het
Poln C T 5: 34,129,452 C124Y probably benign Het
Ppp2r2a T A 14: 67,028,937 I92L probably damaging Het
Prpmp5 T G 6: 132,313,661 Y25S unknown Het
Ptch1 C T 13: 63,534,329 R537H probably damaging Het
Rnf130 T C 11: 50,087,440 V276A possibly damaging Het
Rnf31 AAC A 14: 55,601,098 probably null Het
Rnf38 A T 4: 44,149,100 N82K possibly damaging Het
Scn7a T A 2: 66,676,436 M1370L probably benign Het
Sema4b C A 7: 80,215,651 L125I probably damaging Het
Slc12a7 C T 13: 73,790,734 T210I possibly damaging Het
Sox8 A C 17: 25,567,335 *465G probably null Het
Spg11 G T 2: 122,113,194 T159K possibly damaging Het
Stk36 A G 1: 74,632,807 R889G possibly damaging Het
Tmbim7 A G 5: 3,661,796 S14G probably benign Het
Vmn1r6 C T 6: 57,002,692 A113V possibly damaging Het
Zc3h14 A G 12: 98,763,960 N92D possibly damaging Het
Zfp638 T C 6: 83,984,059 S1206P probably damaging Het
Other mutations in Usp16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01322:Usp16 APN 16 87466276 missense possibly damaging 0.95
IGL01589:Usp16 APN 16 87479183 missense probably benign 0.00
IGL02570:Usp16 APN 16 87480893 missense probably damaging 1.00
IGL02736:Usp16 APN 16 87464835 missense possibly damaging 0.75
IGL02973:Usp16 APN 16 87479739 missense probably damaging 1.00
IGL03066:Usp16 APN 16 87471833 missense probably damaging 1.00
PIT1430001:Usp16 UTSW 16 87473132 missense probably damaging 0.99
R0395:Usp16 UTSW 16 87475446 missense probably damaging 1.00
R0619:Usp16 UTSW 16 87472164 missense probably benign 0.02
R1146:Usp16 UTSW 16 87474648 missense possibly damaging 0.93
R1146:Usp16 UTSW 16 87474648 missense possibly damaging 0.93
R1549:Usp16 UTSW 16 87464834 missense probably damaging 1.00
R1557:Usp16 UTSW 16 87462142 critical splice donor site probably null
R1776:Usp16 UTSW 16 87479316 missense probably damaging 0.97
R1818:Usp16 UTSW 16 87479132 nonsense probably null
R1835:Usp16 UTSW 16 87480907 missense probably damaging 1.00
R2022:Usp16 UTSW 16 87473126 missense probably damaging 1.00
R2146:Usp16 UTSW 16 87473187 critical splice donor site probably null
R2432:Usp16 UTSW 16 87466358 critical splice donor site probably null
R3110:Usp16 UTSW 16 87471848 splice site probably null
R3112:Usp16 UTSW 16 87471848 splice site probably null
R3771:Usp16 UTSW 16 87458683 start codon destroyed probably null 1.00
R4959:Usp16 UTSW 16 87480914 missense probably damaging 0.99
R4973:Usp16 UTSW 16 87480914 missense probably damaging 0.99
R5276:Usp16 UTSW 16 87470451 critical splice donor site probably null
R5753:Usp16 UTSW 16 87482899 missense probably damaging 0.98
R6230:Usp16 UTSW 16 87464798 missense possibly damaging 0.48
R6267:Usp16 UTSW 16 87483191 missense probably benign 0.00
R6473:Usp16 UTSW 16 87483135 missense probably benign 0.00
R6736:Usp16 UTSW 16 87470397 missense probably damaging 1.00
R7006:Usp16 UTSW 16 87471836 missense probably damaging 1.00
R7012:Usp16 UTSW 16 87458744 critical splice donor site probably null
R7040:Usp16 UTSW 16 87480929 missense probably damaging 1.00
R7136:Usp16 UTSW 16 87483171 missense probably benign
R7295:Usp16 UTSW 16 87472089 missense probably benign 0.44
R7434:Usp16 UTSW 16 87479319 nonsense probably null
R7497:Usp16 UTSW 16 87466286 nonsense probably null
R7571:Usp16 UTSW 16 87464835 missense possibly damaging 0.75
R7576:Usp16 UTSW 16 87479300 missense probably benign 0.34
R7624:Usp16 UTSW 16 87476805 missense probably benign 0.23
R7889:Usp16 UTSW 16 87474584 missense probably benign 0.44
R7972:Usp16 UTSW 16 87474584 missense probably benign 0.44
X0061:Usp16 UTSW 16 87479457 missense probably benign 0.01
X0064:Usp16 UTSW 16 87471725 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- ACCTGATAACATGAGCTGTGGTG -3'
(R):5'- AATCTGGCTCAGCATGCTG -3'

Sequencing Primer
(F):5'- TGTGTGTGGAGAAGAGCTGCAG -3'
(R):5'- TGGTTCACACAGCGAATTGC -3'
Posted On2017-12-01