Mutagenetix > Incidental Mutation

Incidental Mutation 'R4435:Mbtd1'

500623

Institutional Source

Beutler Lab

Gene Symbol

Mbtd1

Ensembl Gene

ENSMUSG00000059474

Gene Name

mbt domain containing 1

Synonyms

hemp

MMRRC Submission

041149-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4435 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

93885852-93946985 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 93932222 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 489 (D489E)

Ref Sequence

ENSEMBL: ENSMUSP00000103486 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000063645] [ENSMUST00000063718] [ENSMUST00000107852] [ENSMUST00000107853] [ENSMUST00000107854]

AlphaFold

Q6P5G3

Predicted Effect

probably benign
Transcript: ENSMUST00000063645

SMART Domains

Protein: ENSMUSP00000070248
Gene: ENSMUSG00000059474

Domain	Start	End	E-Value	Type
low complexity region	7	24	N/A	INTRINSIC
PDB:2W0T\|A	52	74	7e-6	PDB
low complexity region	75	90	N/A	INTRINSIC
low complexity region	114	130	N/A	INTRINSIC
MBT	144	248	3.11e-22	SMART
MBT	256	357	1.28e-41	SMART
MBT	361	459	1.61e-38	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000063718
AA Change: D511E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000065442
Gene: ENSMUSG00000059474
AA Change: D511E

Domain	Start	End	E-Value	Type
low complexity region	29	46	N/A	INTRINSIC
PDB:2W0T\|A	74	96	7e-6	PDB
low complexity region	97	112	N/A	INTRINSIC
low complexity region	136	152	N/A	INTRINSIC
MBT	166	270	3.11e-22	SMART
MBT	278	379	1.28e-41	SMART
MBT	383	481	1.61e-38	SMART
MBT	489	585	4.11e-54	SMART
low complexity region	586	614	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000107852

SMART Domains

Protein: ENSMUSP00000103484
Gene: ENSMUSG00000059474

Domain	Start	End	E-Value	Type
low complexity region	7	24	N/A	INTRINSIC
PDB:2W0T\|A	52	74	5e-6	PDB
low complexity region	75	90	N/A	INTRINSIC
low complexity region	114	130	N/A	INTRINSIC
MBT	144	248	3.11e-22	SMART
MBT	256	357	1.28e-41	SMART
MBT	361	433	1.29e-4	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000107853
AA Change: D489E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000103485
Gene: ENSMUSG00000059474
AA Change: D489E

Domain	Start	End	E-Value	Type
low complexity region	7	24	N/A	INTRINSIC
PDB:2W0T\|A	52	74	1e-6	PDB
low complexity region	75	90	N/A	INTRINSIC
low complexity region	114	130	N/A	INTRINSIC
MBT	144	248	1.2e-24	SMART
MBT	256	357	4.8e-44	SMART
MBT	361	459	6.1e-41	SMART
MBT	467	563	1.6e-56	SMART
low complexity region	564	592	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000107854
AA Change: D489E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000103486
Gene: ENSMUSG00000059474
AA Change: D489E

Domain	Start	End	E-Value	Type
low complexity region	7	24	N/A	INTRINSIC
PDB:2W0T\|A	52	74	1e-6	PDB
low complexity region	75	90	N/A	INTRINSIC
low complexity region	114	130	N/A	INTRINSIC
MBT	144	248	1.2e-24	SMART
MBT	256	357	4.9e-44	SMART
MBT	361	459	6.2e-41	SMART
MBT	467	563	1.6e-56	SMART
low complexity region	564	592	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150237

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155518

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155841

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.4%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal lethality and severe abnormalities in hematopoietic stem cell function and skeletal formation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam6b	A	C	12: 113,490,661	Q366P	probably damaging	Het
Adamts16	G	A	13: 70,779,518		probably benign	Het
Ank3	C	T	10: 69,987,070	S523L	probably damaging	Het
Arap1	C	A	7: 101,390,254	R574S	possibly damaging	Het
Arhgap25	T	C	6: 87,462,938	I576V	possibly damaging	Het
Ascc3	T	A	10: 50,721,885	V1283D	probably benign	Het
Asnsd1	A	T	1: 53,348,073		probably null	Het
Asrgl1	C	T	19: 9,119,199	V125I	probably damaging	Het
Bccip	A	G	7: 133,719,213	R239G	probably benign	Het
Cdyl	T	C	13: 35,858,250		probably null	Het
Cyfip1	T	C	7: 55,900,041	I650T	probably damaging	Het
Dennd4c	C	A	4: 86,798,075	Q506K	probably benign	Het
Fam135b	T	C	15: 71,448,739	D1313G	probably damaging	Het
Fam169a	A	G	13: 97,126,740	D567G	probably damaging	Het
Gm5134	T	G	10: 75,995,824	S366A	probably damaging	Het
Gm5849	T	A	3: 90,777,875	K1M	probably null	Het
Gpn3	A	G	5: 122,382,052	D223G	probably benign	Het
Hk1	A	G	10: 62,275,844	Y713H	probably damaging	Het
Ifih1	A	G	2: 62,645,890	L14P	probably damaging	Het
Kmt2c	A	T	5: 25,314,877	N2078K	possibly damaging	Het
Maf	T	A	8: 115,706,853	E4V	unknown	Het
Myrip	C	T	9: 120,335,614		probably benign	Het
Nedd4l	A	G	18: 65,212,825	D816G	possibly damaging	Het
Nwd1	T	C	8: 72,688,136	V934A	possibly damaging	Het
Olfr290	A	G	7: 84,916,021	M81V	probably benign	Het
Olfr446	T	A	6: 42,928,089	I286N	probably damaging	Het
Psd	A	T	19: 46,314,494	I158N	probably damaging	Het
Ptprq	A	G	10: 107,685,055	V752A	possibly damaging	Het
Robo4	CGG	CG	9: 37,411,490		probably null	Het
Senp2	T	A	16: 22,014,241	V93E	possibly damaging	Het
Siah1b	G	A	X: 164,071,692	P131S	probably damaging	Het
Slc38a4	T	C	15: 97,009,018	S280G	probably benign	Het
Sos2	T	C	12: 69,614,699	E666G	possibly damaging	Het
Strip2	T	C	6: 29,925,050	V129A	probably benign	Het
Tsc2	G	A	17: 24,599,713	P1450L	probably benign	Het
Ttn	T	C	2: 76,916,875	E4610G	probably benign	Het
Uimc1	T	C	13: 55,075,823	E212G	probably damaging	Het
Zc3h18	T	C	8: 122,413,952		probably null	Het
Zswim3	T	A	2: 164,820,643	C348S	probably benign	Het

Other mutations in Mbtd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00814:Mbtd1	APN	11	93943840	missense	possibly damaging	0.94
IGL00819:Mbtd1	APN	11	93931811	critical splice acceptor site	probably null
IGL01140:Mbtd1	APN	11	93924432	missense	probably damaging	1.00
IGL01553:Mbtd1	APN	11	93923214	missense	probably benign	0.35
IGL01893:Mbtd1	APN	11	93921412	missense	probably null
IGL02218:Mbtd1	APN	11	93931803	splice site	probably benign
IGL02406:Mbtd1	APN	11	93908858	missense	probably damaging	1.00
IGL03002:Mbtd1	APN	11	93924490	missense	probably benign	0.15
IGL03347:Mbtd1	APN	11	93923179	missense	probably benign	0.01
R0027:Mbtd1	UTSW	11	93924549	missense	possibly damaging	0.85
R0027:Mbtd1	UTSW	11	93924549	missense	possibly damaging	0.85
R0311:Mbtd1	UTSW	11	93921357	splice site	probably null
R0513:Mbtd1	UTSW	11	93932212	splice site	probably null
R0646:Mbtd1	UTSW	11	93905212	missense	probably damaging	1.00
R0734:Mbtd1	UTSW	11	93923146	missense	probably damaging	1.00
R0835:Mbtd1	UTSW	11	93931839	missense	probably benign	0.23
R1295:Mbtd1	UTSW	11	93910359	missense	probably damaging	0.99
R1296:Mbtd1	UTSW	11	93910359	missense	probably damaging	0.99
R1996:Mbtd1	UTSW	11	93932396	frame shift	probably null
R2157:Mbtd1	UTSW	11	93910388	missense	probably benign	0.20
R3977:Mbtd1	UTSW	11	93905175	missense	probably benign
R4589:Mbtd1	UTSW	11	93921419	missense	probably damaging	1.00
R4647:Mbtd1	UTSW	11	93924611	missense	probably damaging	1.00
R4824:Mbtd1	UTSW	11	93925702	missense	probably benign	0.00
R4919:Mbtd1	UTSW	11	93923148	splice site	probably null
R5045:Mbtd1	UTSW	11	93931815	missense	probably benign	0.26
R5095:Mbtd1	UTSW	11	93929671	missense	probably damaging	1.00
R5227:Mbtd1	UTSW	11	93924648	missense	possibly damaging	0.54
R5619:Mbtd1	UTSW	11	93929879	splice site	probably null
R6057:Mbtd1	UTSW	11	93929659	missense	probably damaging	0.99
R6293:Mbtd1	UTSW	11	93932232	missense	possibly damaging	0.79
R6294:Mbtd1	UTSW	11	93932232	missense	possibly damaging	0.79
R6295:Mbtd1	UTSW	11	93932232	missense	possibly damaging	0.79
R6297:Mbtd1	UTSW	11	93932232	missense	possibly damaging	0.79
R6998:Mbtd1	UTSW	11	93924612	missense	probably damaging	1.00
R7423:Mbtd1	UTSW	11	93943796	missense	probably benign	0.38
R7519:Mbtd1	UTSW	11	93908899	missense	probably damaging	1.00
R8250:Mbtd1	UTSW	11	93910350	missense	probably damaging	1.00
R9180:Mbtd1	UTSW	11	93932392	missense	probably damaging	1.00
R9181:Mbtd1	UTSW	11	93912415	missense	probably benign
R9215:Mbtd1	UTSW	11	93943802	missense	possibly damaging	0.67
R9446:Mbtd1	UTSW	11	93943682	missense	unknown
R9474:Mbtd1	UTSW	11	93925685	missense	probably benign
R9575:Mbtd1	UTSW	11	93908938	critical splice donor site	probably null
R9696:Mbtd1	UTSW	11	93932392	missense	probably damaging	1.00
X0024:Mbtd1	UTSW	11	93924549	missense	possibly damaging	0.85
Z1177:Mbtd1	UTSW	11	93912459	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- GCATGATCACGACATAAGAGTG -3'
(R):5'- ATAGAGGTCAGGGGACTCAC -3'

Sequencing Primer
(F):5'- CACGACATAAGAGTGGAAATTTTTC -3'
(R):5'- TCAGGGGACTCACAGTCTAC -3'

Posted On

2017-12-01