Incidental Mutation 'R4465:Stag2'
ID500634
Institutional Source Beutler Lab
Gene Symbol Stag2
Ensembl Gene ENSMUSG00000025862
Gene Namestromal antigen 2
Synonymsnuclear protein SA2, SA-2, 9230105L23Rik, SAP2, B230112I07Rik
MMRRC Submission 041580-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.941) question?
Stock #R4465 (G1)
Quality Score222
Status Not validated
ChromosomeX
Chromosomal Location42149317-42277185 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 42233872 bp
ZygosityHomozygous
Amino Acid Change Serine to Glycine at position 400 (S400G)
Ref Sequence ENSEMBL: ENSMUSP00000110725 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069619] [ENSMUST00000115072] [ENSMUST00000115073]
Predicted Effect probably benign
Transcript: ENSMUST00000069619
AA Change: S400G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000063250
Gene: ENSMUSG00000025862
AA Change: S400G

DomainStartEndE-ValueType
low complexity region 32 68 N/A INTRINSIC
Pfam:STAG 154 273 3e-50 PFAM
SCOP:d1b3ua_ 275 439 2e-3 SMART
low complexity region 501 513 N/A INTRINSIC
low complexity region 1096 1101 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115072
AA Change: S400G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000110724
Gene: ENSMUSG00000025862
AA Change: S400G

DomainStartEndE-ValueType
low complexity region 32 68 N/A INTRINSIC
Pfam:STAG 154 273 3e-50 PFAM
SCOP:d1b3ua_ 275 439 2e-3 SMART
low complexity region 501 513 N/A INTRINSIC
low complexity region 1096 1101 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115073
AA Change: S400G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000110725
Gene: ENSMUSG00000025862
AA Change: S400G

DomainStartEndE-ValueType
low complexity region 32 68 N/A INTRINSIC
Pfam:STAG 157 271 6.3e-41 PFAM
SCOP:d1b3ua_ 275 439 2e-3 SMART
low complexity region 501 513 N/A INTRINSIC
low complexity region 1096 1101 N/A INTRINSIC
coiled coil region 1169 1189 N/A INTRINSIC
Meta Mutation Damage Score 0.0839 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a subunit of the cohesin complex, which regulates the separation of sister chromatids during cell division. Targeted inactivation of this gene results in chromatid cohesion defects and aneuploidy, suggesting that genetic disruption of cohesin is a cause of aneuploidy in human cancer. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2013]
PHENOTYPE: Knockdown of expression of this gene results in lineage skewing of hematopoietic stem cells and myeloproliferative disorders in aged mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik G T 5: 63,898,839 probably benign Het
Acsbg2 A G 17: 56,861,580 Y180H probably damaging Het
Adgrb3 G T 1: 25,094,366 T1213K probably damaging Het
Atrn A G 2: 130,960,468 T510A probably benign Het
Clasp1 C A 1: 118,561,078 T857N probably damaging Het
Cldn8 A C 16: 88,562,731 M102R probably damaging Het
Col12a1 C A 9: 79,672,910 V1562F possibly damaging Het
Cyp4f40 T A 17: 32,671,212 D285E probably benign Het
Dis3 G A 14: 99,084,114 S599L possibly damaging Het
Dnah11 T C 12: 117,987,451 T3041A probably benign Het
Erbin T C 13: 103,844,885 N511D probably benign Het
F11 T A 8: 45,241,474 I617F probably damaging Het
Gm11541 A T 11: 94,704,222 C7S unknown Het
Klk12 A T 7: 43,773,383 R245W probably damaging Het
Lao1 C A 4: 118,965,307 S141R probably benign Het
Lrrk2 A G 15: 91,747,820 K1316E probably damaging Het
Map3k6 A G 4: 133,246,333 Y445C possibly damaging Het
Mup6 T C 4: 60,004,000 I31T probably damaging Het
Ndnf T A 6: 65,704,196 D486E probably benign Het
Olfr1084 A T 2: 86,639,134 N191K probably benign Het
Olfr1097 A T 2: 86,891,150 N8K probably benign Het
Olfr441 T C 6: 43,115,918 Y59H probably damaging Het
Rab19 T C 6: 39,388,126 S107P probably damaging Het
Slc22a29 A T 19: 8,162,724 L439* probably null Het
Slc5a1 A G 5: 33,146,516 E225G possibly damaging Het
Slx4 A G 16: 3,989,055 V508A possibly damaging Het
Snx25 A G 8: 46,068,229 S373P possibly damaging Het
Tas2r107 A G 6: 131,660,009 Y26H probably benign Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Zdhhc22 G A 12: 86,988,223 L152F probably benign Het
Zfpm2 T G 15: 41,096,161 M80R probably benign Het
Other mutations in Stag2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00547:Stag2 APN X 42247015 missense probably benign 0.17
IGL02379:Stag2 APN X 42250597 missense probably benign 0.00
IGL02501:Stag2 APN X 42271325 splice site probably benign
R0194:Stag2 UTSW X 42206137 splice site probably benign
R4057:Stag2 UTSW X 42224942 missense probably damaging 1.00
R4466:Stag2 UTSW X 42233872 missense probably benign 0.00
R4467:Stag2 UTSW X 42233872 missense probably benign 0.00
R5007:Stag2 UTSW X 42266253 missense possibly damaging 0.92
Z1177:Stag2 UTSW X 42229398 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCAGTCATCTTTCATCTTGATACAC -3'
(R):5'- GATAGTGCTTGCATCAAACCAAG -3'

Sequencing Primer
(F):5'- CATCTTTCATCTTGATACACTGAACG -3'
(R):5'- GCTTGCATCAAACCAAGTAAATATTC -3'
Posted On2017-12-01