Incidental Mutation 'R4474:Tmem150a'
ID500640
Institutional Source Beutler Lab
Gene Symbol Tmem150a
Ensembl Gene ENSMUSG00000055912
Gene Nametransmembrane protein 150A
SynonymsTmem150
MMRRC Submission 041731-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.667) question?
Stock #R4474 (G1)
Quality Score220
Status Not validated
Chromosome6
Chromosomal Location72355447-72359762 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 72357052 bp
ZygosityHeterozygous
Amino Acid Change Serine to Phenylalanine at position 39 (S39F)
Ref Sequence ENSEMBL: ENSMUSP00000138445 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069580] [ENSMUST00000069595] [ENSMUST00000069695] [ENSMUST00000077783] [ENSMUST00000114095] [ENSMUST00000130064] [ENSMUST00000132243] [ENSMUST00000149296] [ENSMUST00000151063] [ENSMUST00000154098] [ENSMUST00000206064] [ENSMUST00000206531]
Predicted Effect probably benign
Transcript: ENSMUST00000069580
SMART Domains Protein: ENSMUSP00000066128
Gene: ENSMUSG00000055850

DomainStartEndE-ValueType
RING 88 128 5.51e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000069595
SMART Domains Protein: ENSMUSP00000070370
Gene: ENSMUSG00000055850

DomainStartEndE-ValueType
RING 20 60 5.51e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000069695
AA Change: S39F

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000063977
Gene: ENSMUSG00000055912
AA Change: S39F

DomainStartEndE-ValueType
Pfam:Frag1 3 232 3.8e-63 PFAM
low complexity region 251 259 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000077783
SMART Domains Protein: ENSMUSP00000076957
Gene: ENSMUSG00000058706

DomainStartEndE-ValueType
Pfam:UPF0561 1 126 4.4e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114095
SMART Domains Protein: ENSMUSP00000109729
Gene: ENSMUSG00000055850

DomainStartEndE-ValueType
RING 88 155 2.82e-4 SMART
low complexity region 185 196 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125554
Predicted Effect probably benign
Transcript: ENSMUST00000126065
Predicted Effect probably benign
Transcript: ENSMUST00000129233
Predicted Effect probably benign
Transcript: ENSMUST00000130064
SMART Domains Protein: ENSMUSP00000115187
Gene: ENSMUSG00000055850

DomainStartEndE-ValueType
RING 32 72 5.51e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132243
AA Change: S39F

PolyPhen 2 Score 0.272 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000138445
Gene: ENSMUSG00000055912
AA Change: S39F

DomainStartEndE-ValueType
Pfam:Frag1 3 69 7.2e-12 PFAM
low complexity region 139 154 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133978
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136707
Predicted Effect probably benign
Transcript: ENSMUST00000149296
Predicted Effect probably benign
Transcript: ENSMUST00000151063
Predicted Effect probably benign
Transcript: ENSMUST00000154098
SMART Domains Protein: ENSMUSP00000138327
Gene: ENSMUSG00000055850

DomainStartEndE-ValueType
RING 41 81 5.51e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205399
Predicted Effect probably benign
Transcript: ENSMUST00000206064
AA Change: S39F

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206319
Predicted Effect probably benign
Transcript: ENSMUST00000206531
AA Change: S23F

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206821
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 95% (36/38)
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 A T 11: 110,233,772 I397K possibly damaging Het
Alpk1 T C 3: 127,680,018 T779A probably damaging Het
Cdh23 G T 10: 60,311,086 A2795D probably damaging Het
Cdk19 G A 10: 40,469,956 probably null Het
Cep104 T A 4: 153,989,236 M476K possibly damaging Het
Csf1 T C 3: 107,753,856 D115G probably damaging Het
Dclre1b C A 3: 103,807,243 probably benign Het
Fbp1 A G 13: 62,875,261 L74P probably damaging Het
Gm9573 G T 17: 35,620,604 probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Hydin G T 8: 110,563,865 V3319L probably benign Het
Kcna4 A G 2: 107,296,007 N362S probably benign Het
Kif13a C T 13: 46,814,155 probably null Het
Lingo2 T C 4: 35,708,810 E390G probably benign Het
Mdh1 T G 11: 21,566,624 D33A possibly damaging Het
Mov10 C T 3: 104,818,465 G21D probably damaging Het
Olfr1305 G A 2: 111,873,439 R139W possibly damaging Het
Olfr851 T A 9: 19,496,877 L43Q probably damaging Het
Parn A G 16: 13,664,685 S100P probably benign Het
Pik3c2g T A 6: 139,633,751 Y332N probably damaging Het
Rab22a C T 2: 173,695,263 T85M probably damaging Het
Rims2 A G 15: 39,462,560 S763G probably damaging Het
Sarm1 T A 11: 78,497,101 I120L probably benign Het
Siah1b G A X: 164,071,692 P131S probably damaging Het
Snx31 A G 15: 36,546,111 probably benign Het
Tsc2 T A 17: 24,597,264 H1605L probably damaging Het
Ugt1a10 TAAAAAAAAA TAAAAAAA 1: 88,215,928 probably benign Het
Vmn2r95 T C 17: 18,452,245 L820P probably damaging Het
Zfp36l3 T C X: 53,775,957 N97D possibly damaging Het
Other mutations in Tmem150a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01061:Tmem150a APN 6 72357118 missense probably damaging 0.96
R0070:Tmem150a UTSW 6 72358759 splice site probably null
R0070:Tmem150a UTSW 6 72358759 splice site probably null
R6170:Tmem150a UTSW 6 72356745 missense probably benign 0.03
R7506:Tmem150a UTSW 6 72356770 critical splice donor site probably null
R7723:Tmem150a UTSW 6 72359074 missense probably damaging 0.96
R7751:Tmem150a UTSW 6 72359045 missense probably damaging 1.00
R7783:Tmem150a UTSW 6 72358623 missense unknown
Predicted Primers PCR Primer
(F):5'- GCATGACATCCTGTTCATCTGC -3'
(R):5'- GGATGCCCAGCTCCTAGAAATAG -3'

Sequencing Primer
(F):5'- ACATCCTGTTCATCTGCCCACTTC -3'
(R):5'- ACTGCTTTCCAAGAGCTAGG -3'
Posted On2017-12-01