Incidental Mutation 'R4514:Atm'
ID500641
Institutional Source Beutler Lab
Gene Symbol Atm
Ensembl Gene ENSMUSG00000034218
Gene Nameataxia telangiectasia mutated
SynonymsC030026E19Rik
MMRRC Submission 041588-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.863) question?
Stock #R4514 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location53439149-53536740 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 53493039 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 1334 (Q1334L)
Ref Sequence ENSEMBL: ENSMUSP00000156344 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000118282] [ENSMUST00000232179]
Predicted Effect probably damaging
Transcript: ENSMUST00000118282
AA Change: Q1334L

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000113388
Gene: ENSMUSG00000034218
AA Change: Q1334L

DomainStartEndE-ValueType
TAN 1 166 5.07e-68 SMART
low complexity region 431 445 N/A INTRINSIC
low complexity region 830 846 N/A INTRINSIC
low complexity region 929 940 N/A INTRINSIC
SCOP:d1gw5a_ 1039 1568 2e-4 SMART
coiled coil region 1615 1644 N/A INTRINSIC
low complexity region 1650 1662 N/A INTRINSIC
Pfam:FAT 2102 2499 4.4e-50 PFAM
low complexity region 2587 2599 N/A INTRINSIC
PI3Kc 2723 3026 1.11e-117 SMART
FATC 3034 3066 3.71e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000232179
AA Change: Q1334L

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the PI3/PI4-kinase family. This protein is an important cell cycle checkpoint kinase that phosphorylates; thus, it functions as a regulator of a wide variety of downstream proteins, including tumor suppressor proteins p53 and BRCA1, checkpoint kinase CHK2, checkpoint proteins RAD17 and RAD9, and DNA repair protein NBS1. This protein and the closely related kinase ATR are thought to be master controllers of cell cycle checkpoint signaling pathways that are required for cell response to DNA damage and for genome stability. Mutations in this gene are associated with ataxia telangiectasia, an autosomal recessive disorder. [provided by RefSeq, Aug 2010]
PHENOTYPE: Homozygotes for null mutations may exhibit locomotor abnormalities, motor learning deficits, growth retardation, sterility due to meiotic arrest, and susceptibility to thymic lymphomas. Mice homozygous for a kinase dead allele exhibit early embryonic lethality associated with genetic instability. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam5 T G 8: 24,818,136 T51P probably damaging Het
Akr1c20 A C 13: 4,507,844 V201G probably damaging Het
Alg9 C T 9: 50,805,354 T409M possibly damaging Het
Arpp21 T A 9: 112,177,677 T155S probably damaging Het
Bptf G A 11: 107,077,692 T1055M probably damaging Het
Cd3g C A 9: 44,973,584 A121S possibly damaging Het
Cenpn A G 8: 116,933,396 Y68C probably damaging Het
Clock A G 5: 76,230,199 I618T probably benign Het
Cp A G 3: 19,988,013 M982V probably damaging Het
Csf3r T A 4: 126,039,860 S611T possibly damaging Het
Csn3 A G 5: 87,930,138 T168A unknown Het
Cylc2 C G 4: 51,229,651 T331R unknown Het
D630003M21Rik T C 2: 158,204,802 T752A probably benign Het
Defb34 A T 8: 19,126,506 D71V probably damaging Het
Dync1h1 T A 12: 110,657,139 D3615E possibly damaging Het
Etl4 A T 2: 20,661,898 T167S probably damaging Het
F5 T A 1: 164,151,997 probably benign Het
Got1l1 C T 8: 27,198,485 M279I probably benign Het
Grm7 A G 6: 111,358,304 T559A possibly damaging Het
Ifit1 A T 19: 34,648,513 R350* probably null Het
Ighv2-5 T C 12: 113,685,596 N79S possibly damaging Het
Igkv17-127 A G 6: 67,861,514 I70V possibly damaging Het
Itga8 T C 2: 12,182,736 S711G probably benign Het
Kndc1 A G 7: 139,910,286 T235A probably benign Het
Lct T C 1: 128,300,514 I1081V probably benign Het
Lrrc8b G T 5: 105,479,953 C55F probably damaging Het
Lrwd1 T C 5: 136,131,548 T311A probably benign Het
Mapk14 T C 17: 28,724,824 F129S probably damaging Het
Mdga2 A G 12: 66,716,722 I200T probably damaging Het
Mocos T A 18: 24,683,212 S615R probably damaging Het
Myh4 T C 11: 67,255,569 V1456A probably benign Het
Myh9 T C 15: 77,764,000 I1759V probably benign Het
Nat8f5 G A 6: 85,817,423 T185I possibly damaging Het
Nav3 T C 10: 109,694,082 I2133V possibly damaging Het
Ncam2 T A 16: 81,512,996 M458K probably benign Het
Nphp1 T C 2: 127,748,087 S532G probably benign Het
Olfr1184 T C 2: 88,487,365 V211A probably benign Het
Olfr649 C T 7: 104,189,391 R272H probably benign Het
Oplah A G 15: 76,297,955 L1035P probably damaging Het
Pask T A 1: 93,322,133 Q515L probably benign Het
Poglut1 A T 16: 38,549,416 F35I probably benign Het
Ppp1ca T G 19: 4,195,055 I319S probably benign Het
Psg25 T A 7: 18,529,608 R97* probably null Het
Sars2 T C 7: 28,742,284 probably null Het
Slc15a4 A G 5: 127,604,536 probably null Het
Slc16a7 T G 10: 125,233,439 probably null Het
Slc7a8 C G 14: 54,735,790 G240A possibly damaging Het
St6gal2 A T 17: 55,483,017 N351Y probably benign Het
Susd5 T C 9: 114,095,924 F292L probably benign Het
Tmco5 T A 2: 116,880,314 D38E probably damaging Het
Tubgcp2 G A 7: 139,996,071 P893L possibly damaging Het
Uncx A G 5: 139,546,767 I196V possibly damaging Het
Zeb1 G A 18: 5,759,007 C138Y probably damaging Het
Zfp609 A G 9: 65,703,695 I662T possibly damaging Het
Zfp985 G A 4: 147,583,563 C296Y probably damaging Het
Other mutations in Atm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Atm APN 9 53524443 missense probably damaging 1.00
IGL00466:Atm APN 9 53499112 splice site probably benign
IGL00567:Atm APN 9 53503116 nonsense probably null
IGL00702:Atm APN 9 53511831 missense probably benign 0.02
IGL00743:Atm APN 9 53513116 missense probably benign 0.00
IGL00771:Atm APN 9 53493054 missense probably benign 0.01
IGL00773:Atm APN 9 53522144 missense probably benign 0.00
IGL00819:Atm APN 9 53518531 missense probably damaging 1.00
IGL00864:Atm APN 9 53533933 missense probably damaging 0.99
IGL00985:Atm APN 9 53459816 missense probably damaging 0.98
IGL01109:Atm APN 9 53490293 missense probably damaging 1.00
IGL01120:Atm APN 9 53461122 critical splice acceptor site probably null
IGL01369:Atm APN 9 53515317 missense probably benign
IGL01374:Atm APN 9 53531724 missense possibly damaging 0.58
IGL01406:Atm APN 9 53439746 makesense probably null
IGL01409:Atm APN 9 53499171 missense probably benign 0.01
IGL01434:Atm APN 9 53507807 missense probably benign 0.04
IGL01486:Atm APN 9 53510213 missense probably benign
IGL01583:Atm APN 9 53484247 splice site probably benign
IGL01861:Atm APN 9 53494612 missense probably null 0.89
IGL01865:Atm APN 9 53461002 missense probably damaging 1.00
IGL02026:Atm APN 9 53442417 unclassified probably null
IGL02072:Atm APN 9 53459796 missense probably benign 0.01
IGL02075:Atm APN 9 53527237 missense probably damaging 1.00
IGL02127:Atm APN 9 53487983 missense probably damaging 1.00
IGL02175:Atm APN 9 53480665 missense probably damaging 0.99
IGL02246:Atm APN 9 53527185 missense probably benign 0.12
IGL02259:Atm APN 9 53518494 splice site probably benign
IGL02351:Atm APN 9 53522176 missense probably benign 0.04
IGL02358:Atm APN 9 53522176 missense probably benign 0.04
IGL02387:Atm APN 9 53479766 splice site probably null
IGL02417:Atm APN 9 53479695 missense probably benign 0.00
IGL02422:Atm APN 9 53500792 missense probably damaging 1.00
IGL02445:Atm APN 9 53454330 missense probably benign 0.00
IGL02492:Atm APN 9 53455859 missense probably damaging 0.99
IGL02513:Atm APN 9 53497262 splice site probably benign
IGL02633:Atm APN 9 53448153 missense probably damaging 1.00
IGL02634:Atm APN 9 53516563 missense probably benign 0.00
IGL02948:Atm APN 9 53453440 splice site probably benign
IGL02959:Atm APN 9 53471418 missense probably damaging 1.00
IGL02965:Atm APN 9 53453563 missense probably damaging 1.00
IGL03085:Atm APN 9 53484171 missense possibly damaging 0.89
antebellum UTSW 9 53518559 nonsense probably null
Civil UTSW 9 53492268 missense possibly damaging 0.78
Grant UTSW 9 53511917 nonsense probably null
mockingbird UTSW 9 53516467 nonsense probably null
mockingbird2 UTSW 9 53488587 missense probably damaging 1.00
osphere UTSW 9 53479673 missense probably damaging 0.99
shiloh UTSW 9 53465298 missense probably damaging 1.00
Strato UTSW 9 53503018 missense probably damaging 1.00
tropo UTSW 9 53531648 missense probably damaging 1.00
P0019:Atm UTSW 9 53465028 splice site probably benign
PIT4403001:Atm UTSW 9 53500982 missense probably benign
PIT4687001:Atm UTSW 9 53486812 critical splice donor site probably null
R0004:Atm UTSW 9 53453528 splice site probably benign
R0035:Atm UTSW 9 53513180 missense probably benign 0.01
R0098:Atm UTSW 9 53518569 missense probably benign 0.10
R0098:Atm UTSW 9 53518569 missense probably benign 0.10
R0201:Atm UTSW 9 53454279 splice site probably benign
R0304:Atm UTSW 9 53516344 missense probably benign 0.34
R0308:Atm UTSW 9 53454473 intron probably null
R0362:Atm UTSW 9 53458838 missense possibly damaging 0.90
R0470:Atm UTSW 9 53460966 missense probably damaging 1.00
R0513:Atm UTSW 9 53503948 missense probably benign 0.00
R0589:Atm UTSW 9 53490192 missense possibly damaging 0.51
R0617:Atm UTSW 9 53458941 nonsense probably null
R0630:Atm UTSW 9 53531622 splice site probably benign
R0652:Atm UTSW 9 53486014 missense probably damaging 0.98
R0698:Atm UTSW 9 53515239 missense probably damaging 1.00
R0737:Atm UTSW 9 53456566 missense probably damaging 1.00
R0885:Atm UTSW 9 53459823 missense probably benign
R0947:Atm UTSW 9 53504092 missense probably benign 0.01
R0948:Atm UTSW 9 53495958 missense probably benign
R1144:Atm UTSW 9 53511698 splice site probably benign
R1252:Atm UTSW 9 53455840 missense probably damaging 1.00
R1295:Atm UTSW 9 53456530 missense probably damaging 1.00
R1296:Atm UTSW 9 53456530 missense probably damaging 1.00
R1419:Atm UTSW 9 53457489 missense probably benign 0.00
R1477:Atm UTSW 9 53464273 missense probably benign 0.00
R1596:Atm UTSW 9 53453378 missense probably damaging 1.00
R1630:Atm UTSW 9 53479673 missense probably damaging 0.99
R1667:Atm UTSW 9 53500932 missense probably damaging 1.00
R1681:Atm UTSW 9 53522155 missense possibly damaging 0.94
R1703:Atm UTSW 9 53500700 missense probably benign
R1817:Atm UTSW 9 53492233 splice site probably benign
R1840:Atm UTSW 9 53456530 missense probably damaging 1.00
R1848:Atm UTSW 9 53468012 missense probably benign 0.06
R1906:Atm UTSW 9 53506568 missense probably damaging 1.00
R1958:Atm UTSW 9 53471418 missense probably damaging 1.00
R2108:Atm UTSW 9 53443997 missense probably damaging 1.00
R2116:Atm UTSW 9 53500969 missense probably benign 0.36
R2134:Atm UTSW 9 53467964 critical splice donor site probably null
R2137:Atm UTSW 9 53453375 missense probably damaging 1.00
R2291:Atm UTSW 9 53490909 splice site probably null
R2348:Atm UTSW 9 53492268 missense possibly damaging 0.78
R2483:Atm UTSW 9 53510266 missense probably damaging 1.00
R2567:Atm UTSW 9 53457470 missense possibly damaging 0.72
R2897:Atm UTSW 9 53507805 missense probably damaging 0.99
R2939:Atm UTSW 9 53494711 missense probably damaging 1.00
R3008:Atm UTSW 9 53480750 missense probably benign 0.00
R3236:Atm UTSW 9 53479748 missense probably benign 0.15
R3847:Atm UTSW 9 53503075 missense possibly damaging 0.94
R3889:Atm UTSW 9 53506636 splice site probably benign
R3919:Atm UTSW 9 53492278 missense probably benign 0.00
R4125:Atm UTSW 9 53450621 missense probably damaging 1.00
R4222:Atm UTSW 9 53480669 missense probably benign
R4395:Atm UTSW 9 53465227 missense probably benign 0.09
R4466:Atm UTSW 9 53448169 nonsense probably null
R4502:Atm UTSW 9 53495946 missense possibly damaging 0.92
R4528:Atm UTSW 9 53500759 missense probably benign 0.39
R4593:Atm UTSW 9 53453594 missense possibly damaging 0.55
R4627:Atm UTSW 9 53456506 missense possibly damaging 0.79
R4634:Atm UTSW 9 53531733 missense probably benign 0.01
R4665:Atm UTSW 9 53464229 missense probably benign 0.00
R4672:Atm UTSW 9 53522201 missense probably damaging 0.99
R4741:Atm UTSW 9 53453607 missense probably benign 0.10
R4808:Atm UTSW 9 53445495 missense probably damaging 0.99
R4959:Atm UTSW 9 53515301 missense probably benign
R4996:Atm UTSW 9 53524507 missense probably benign 0.09
R5030:Atm UTSW 9 53520109 nonsense probably null
R5214:Atm UTSW 9 53491027 missense probably benign 0.09
R5260:Atm UTSW 9 53506611 missense probably damaging 0.99
R5311:Atm UTSW 9 53518623 missense probably benign 0.00
R5394:Atm UTSW 9 53507777 critical splice donor site probably null
R5400:Atm UTSW 9 53503018 missense probably damaging 1.00
R5436:Atm UTSW 9 53459804 missense probably benign 0.00
R5441:Atm UTSW 9 53516467 nonsense probably null
R5569:Atm UTSW 9 53516450 nonsense probably null
R5856:Atm UTSW 9 53495955 missense possibly damaging 0.64
R5891:Atm UTSW 9 53497159 missense probably benign
R5910:Atm UTSW 9 53448080 missense probably damaging 0.96
R6054:Atm UTSW 9 53459873 missense probably damaging 1.00
R6062:Atm UTSW 9 53488587 missense probably damaging 1.00
R6092:Atm UTSW 9 53524414 missense probably damaging 1.00
R6127:Atm UTSW 9 53524509 missense probably damaging 1.00
R6160:Atm UTSW 9 53490959 missense probably benign 0.04
R6267:Atm UTSW 9 53444000 missense probably damaging 1.00
R6273:Atm UTSW 9 53487922 missense probably benign 0.09
R6284:Atm UTSW 9 53445376 splice site probably null
R6478:Atm UTSW 9 53490254 missense probably damaging 1.00
R6547:Atm UTSW 9 53440157 missense probably damaging 1.00
R6549:Atm UTSW 9 53493177 missense probably benign 0.00
R6704:Atm UTSW 9 53458853 missense probably benign 0.02
R6715:Atm UTSW 9 53531648 missense probably damaging 1.00
R6737:Atm UTSW 9 53486051 missense probably benign 0.30
R6759:Atm UTSW 9 53518559 nonsense probably null
R6766:Atm UTSW 9 53490282 missense probably damaging 0.99
R6813:Atm UTSW 9 53497235 missense probably benign 0.00
R6852:Atm UTSW 9 53482430 missense possibly damaging 0.93
R7064:Atm UTSW 9 53507881 missense probably benign 0.02
R7208:Atm UTSW 9 53512008 intron probably null
R7211:Atm UTSW 9 53488560 missense probably benign 0.01
R7220:Atm UTSW 9 53511917 nonsense probably null
R7336:Atm UTSW 9 53462503 missense possibly damaging 0.47
R7363:Atm UTSW 9 53465298 missense probably damaging 1.00
R7378:Atm UTSW 9 53453437 critical splice acceptor site probably null
R7472:Atm UTSW 9 53448125 missense possibly damaging 0.81
R7487:Atm UTSW 9 53524354 missense probably benign
R7497:Atm UTSW 9 53511891 missense probably benign 0.00
R7584:Atm UTSW 9 53513127 missense probably damaging 0.99
R7624:Atm UTSW 9 53454768 missense probably damaging 0.99
R7653:Atm UTSW 9 53490302 nonsense probably null
R7660:Atm UTSW 9 53445507 missense probably benign 0.01
R7679:Atm UTSW 9 53442497 missense probably damaging 1.00
R7720:Atm UTSW 9 53522239 missense possibly damaging 0.54
X0067:Atm UTSW 9 53479694 missense probably benign 0.00
Z1088:Atm UTSW 9 53531687 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGAAGTCTTTAGAGCTGCCAG -3'
(R):5'- AGCCATTTTGATGAGGTGAAGTC -3'

Sequencing Primer
(F):5'- TGCCAGCGCATATCCAGGATC -3'
(R):5'- GGTGAAGTCCATTGCTAATCAG -3'
Posted On2017-12-01