Incidental Mutation 'R4529:Tubgcp3'
ID500646
Institutional Source Beutler Lab
Gene Symbol Tubgcp3
Ensembl Gene ENSMUSG00000000759
Gene Nametubulin, gamma complex associated protein 3
SynonymsSpc98p, GCP3
MMRRC Submission 041592-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.968) question?
Stock #R4529 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location12614277-12672248 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 12663932 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Isoleucine at position 62 (L62I)
Ref Sequence ENSEMBL: ENSMUSP00000127741 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000776] [ENSMUST00000164774]
Predicted Effect possibly damaging
Transcript: ENSMUST00000000776
AA Change: L62I

PolyPhen 2 Score 0.771 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000000776
Gene: ENSMUSG00000000759
AA Change: L62I

DomainStartEndE-ValueType
low complexity region 152 171 N/A INTRINSIC
Pfam:Spc97_Spc98 251 761 9.5e-124 PFAM
coiled coil region 787 814 N/A INTRINSIC
low complexity region 821 827 N/A INTRINSIC
low complexity region 890 903 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158016
Predicted Effect probably damaging
Transcript: ENSMUST00000164774
AA Change: L62I

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000127741
Gene: ENSMUSG00000000759
AA Change: L62I

DomainStartEndE-ValueType
low complexity region 152 171 N/A INTRINSIC
Pfam:Spc97_Spc98 251 361 3.5e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167547
Predicted Effect unknown
Transcript: ENSMUST00000172056
AA Change: L38I
Meta Mutation Damage Score 0.1189 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgre1 A G 17: 57,420,519 Y483C possibly damaging Het
Akap9 T A 5: 4,043,948 F2157I probably damaging Het
Aldh1a3 T C 7: 66,401,994 N404D probably benign Het
Ankrd2 A T 19: 42,043,801 I231F probably benign Het
Apba1 A G 19: 23,936,535 N641D probably damaging Het
C1qbp T C 11: 70,978,724 T178A probably benign Het
Chtf18 T C 17: 25,720,618 Y64C probably damaging Het
Cyp1a1 A G 9: 57,701,679 H281R probably benign Het
Ehmt2 A G 17: 34,913,731 I1235V probably damaging Het
Fam122c G A X: 53,293,499 R94H possibly damaging Het
Fcamr A G 1: 130,804,576 H44R probably damaging Het
Gm12185 T C 11: 48,908,094 N524S possibly damaging Het
Gm12185 T C 11: 48,907,920 Y582C probably damaging Het
Gm5460 A C 14: 34,045,812 D459A probably damaging Het
H2-Q6 C T 17: 35,425,844 T203I probably null Het
Inmt T C 6: 55,171,027 M206V probably benign Het
Khdc3 T C 9: 73,104,019 S360P possibly damaging Het
Lin54 G A 5: 100,446,560 T582I possibly damaging Het
Ltbp1 T G 17: 75,151,360 V312G probably benign Het
Nlrp9a T C 7: 26,571,407 L899P probably damaging Het
Olfr786 T C 10: 129,437,418 V202A probably benign Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Pappa A G 4: 65,231,182 I920V probably benign Het
Parp1 T A 1: 180,591,312 V679E probably damaging Het
Pla2g4f C T 2: 120,300,619 R785Q probably damaging Het
Plbd1 T A 6: 136,651,825 I82F probably benign Het
Plekhm3 A G 1: 64,937,825 V162A probably benign Het
Plin4 A G 17: 56,104,274 L919P probably damaging Het
Plxna4 C T 6: 32,496,896 probably null Het
Pou3f3 C A 1: 42,698,554 T470K probably benign Het
Prss38 T C 11: 59,373,499 Y214C probably damaging Het
Retreg1 T A 15: 25,968,514 Y109N probably damaging Het
Slco1c1 A G 6: 141,555,181 Y413C probably damaging Het
Stk32a T C 18: 43,242,979 C38R possibly damaging Het
Themis T C 10: 28,782,335 F453L possibly damaging Het
Tmem38a C T 8: 72,572,161 P20S possibly damaging Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Xpo7 G A 14: 70,668,748 T986M probably damaging Het
Zfp51 C T 17: 21,464,736 L538F probably damaging Het
Zfy1 A G Y: 726,511 L418S possibly damaging Het
Other mutations in Tubgcp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00424:Tubgcp3 APN 8 12621809 missense probably benign 0.00
IGL00583:Tubgcp3 APN 8 12621906 nonsense probably null
IGL01289:Tubgcp3 APN 8 12639625 missense probably damaging 1.00
IGL01578:Tubgcp3 APN 8 12661297 splice site probably benign
IGL01716:Tubgcp3 APN 8 12641094 splice site probably benign
IGL01943:Tubgcp3 APN 8 12654301 missense probably damaging 1.00
IGL02020:Tubgcp3 APN 8 12637780 missense possibly damaging 0.46
IGL02345:Tubgcp3 APN 8 12625056 missense probably damaging 1.00
IGL02555:Tubgcp3 APN 8 12639595 missense probably benign 0.36
IGL02644:Tubgcp3 APN 8 12648733 missense probably damaging 1.00
IGL02976:Tubgcp3 APN 8 12632300 missense probably damaging 1.00
IGL03240:Tubgcp3 APN 8 12649797 missense probably benign 0.07
IGL03287:Tubgcp3 APN 8 12639630 missense possibly damaging 0.77
Tinky_winky UTSW 8 12650171 missense probably damaging 1.00
R0145:Tubgcp3 UTSW 8 12657561 missense probably benign 0.01
R0379:Tubgcp3 UTSW 8 12641116 missense probably damaging 0.97
R0558:Tubgcp3 UTSW 8 12653462 missense probably benign 0.00
R1490:Tubgcp3 UTSW 8 12639550 missense probably damaging 1.00
R1709:Tubgcp3 UTSW 8 12639532 nonsense probably null
R1768:Tubgcp3 UTSW 8 12649686 unclassified probably benign
R1921:Tubgcp3 UTSW 8 12621932 nonsense probably null
R1928:Tubgcp3 UTSW 8 12663988 missense possibly damaging 0.94
R2161:Tubgcp3 UTSW 8 12632292 missense probably benign 0.22
R3120:Tubgcp3 UTSW 8 12657626 missense possibly damaging 0.51
R3434:Tubgcp3 UTSW 8 12658381 splice site probably null
R4011:Tubgcp3 UTSW 8 12639634 nonsense probably null
R4162:Tubgcp3 UTSW 8 12639547 missense possibly damaging 0.46
R4300:Tubgcp3 UTSW 8 12657600 missense probably damaging 0.99
R4350:Tubgcp3 UTSW 8 12641117 missense probably benign 0.19
R4530:Tubgcp3 UTSW 8 12663932 missense probably damaging 0.98
R4531:Tubgcp3 UTSW 8 12663932 missense probably damaging 0.98
R4676:Tubgcp3 UTSW 8 12650171 missense probably damaging 1.00
R4730:Tubgcp3 UTSW 8 12657654 missense probably benign 0.03
R4828:Tubgcp3 UTSW 8 12671987 missense probably benign
R4860:Tubgcp3 UTSW 8 12649722 missense probably benign 0.03
R4860:Tubgcp3 UTSW 8 12649722 missense probably benign 0.03
R5610:Tubgcp3 UTSW 8 12639577 missense probably damaging 1.00
R5625:Tubgcp3 UTSW 8 12624888 missense possibly damaging 0.46
R5650:Tubgcp3 UTSW 8 12648670 missense probably damaging 0.98
R5775:Tubgcp3 UTSW 8 12625056 missense probably damaging 1.00
R6257:Tubgcp3 UTSW 8 12649835 splice site probably null
R6314:Tubgcp3 UTSW 8 12648625 missense probably benign 0.02
R6970:Tubgcp3 UTSW 8 12637000 missense probably damaging 0.98
R7173:Tubgcp3 UTSW 8 12639259 splice site probably null
R7408:Tubgcp3 UTSW 8 12661359 nonsense probably null
R7502:Tubgcp3 UTSW 8 12641207 missense probably damaging 0.99
R7701:Tubgcp3 UTSW 8 12655974 missense probably benign
R7739:Tubgcp3 UTSW 8 12657561 missense probably benign 0.01
R8169:Tubgcp3 UTSW 8 12616099 missense probably benign
R8327:Tubgcp3 UTSW 8 12654343 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- TGCCTCCAAGCGTGGTTAAC -3'
(R):5'- TGTGCTCTGGTGATGAAAGC -3'

Sequencing Primer
(F):5'- CTCCAAGCGTGGTTAACTGCATTAG -3'
(R):5'- AGCTGTCAGGTTATAACTTGCACC -3'
Posted On2017-12-01