Incidental Mutation 'R4535:Hormad1'
ID500649
Institutional Source Beutler Lab
Gene Symbol Hormad1
Ensembl Gene ENSMUSG00000028109
Gene NameHORMA domain containing 1
SynonymsNohma, 4921522K05Rik
Accession Numbers

Genbank: NM_026489.2; Ensembl: ENSMUST00000107154, ENSMUST00000090797, ENSMUST00000029754, ENSMUST00000171191

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4535 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location95559677-95587671 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 95585141 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 343 (V343A)
Ref Sequence ENSEMBL: ENSMUSP00000102772 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029754] [ENSMUST00000060323] [ENSMUST00000090797] [ENSMUST00000098861] [ENSMUST00000107154] [ENSMUST00000171191] [ENSMUST00000177390]
Predicted Effect probably benign
Transcript: ENSMUST00000029754
AA Change: V343A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000029754
Gene: ENSMUSG00000028109
AA Change: V343A

DomainStartEndE-ValueType
Pfam:HORMA 24 221 4.7e-63 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000060323
SMART Domains Protein: ENSMUSP00000058654
Gene: ENSMUSG00000046519

DomainStartEndE-ValueType
Pfam:GPP34 50 275 8.5e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000090797
AA Change: V343A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000088303
Gene: ENSMUSG00000028109
AA Change: V343A

DomainStartEndE-ValueType
Pfam:HORMA 23 221 5.4e-60 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000098861
SMART Domains Protein: ENSMUSP00000096460
Gene: ENSMUSG00000046519

DomainStartEndE-ValueType
low complexity region 58 69 N/A INTRINSIC
low complexity region 72 83 N/A INTRINSIC
Pfam:GPP34 106 277 5.1e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107154
AA Change: V343A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000102772
Gene: ENSMUSG00000028109
AA Change: V343A

DomainStartEndE-ValueType
Pfam:HORMA 23 221 5.4e-60 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171191
AA Change: V343A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000127180
Gene: ENSMUSG00000028109
AA Change: V343A

DomainStartEndE-ValueType
Pfam:HORMA 23 221 5.4e-60 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176541
Predicted Effect probably benign
Transcript: ENSMUST00000176674
SMART Domains Protein: ENSMUSP00000134885
Gene: ENSMUSG00000046519

DomainStartEndE-ValueType
low complexity region 58 69 N/A INTRINSIC
low complexity region 72 83 N/A INTRINSIC
Pfam:GPP34 104 288 2.4e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176755
SMART Domains Protein: ENSMUSP00000134804
Gene: ENSMUSG00000046519

DomainStartEndE-ValueType
low complexity region 56 67 N/A INTRINSIC
low complexity region 70 81 N/A INTRINSIC
Pfam:GPP34 104 275 7.5e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177389
Predicted Effect probably benign
Transcript: ENSMUST00000177390
SMART Domains Protein: ENSMUSP00000134799
Gene: ENSMUSG00000046519

DomainStartEndE-ValueType
low complexity region 58 69 N/A INTRINSIC
low complexity region 72 83 N/A INTRINSIC
Pfam:GPP34 106 332 8.3e-61 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177399
SMART Domains Protein: ENSMUSP00000134998
Gene: ENSMUSG00000046519

DomainStartEndE-ValueType
Pfam:GPP34 23 170 5.4e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198013
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a HORMA domain-containing protein. HORMA domains are involved in chromatin binding and play a role in cell cycle regulation. The encoded protein may play a role in meiosis, and expression of this gene is a potential marker for cancer. A pseudogene of this gene is located on the long arm of chromosome 6. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2010]
PHENOTYPE: Homozgous mice are infertile because of meiosis arrest associated with impaired synaptonemal-complex formation. [provided by MGI curators]
Allele List at MGI

All alleles(9) : Targeted, knock-out(1) Targeted, other(1) Gene trapped(7)

Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef4 T C 1: 34,723,081 S473P unknown Het
Azin1 A T 15: 38,493,605 I258N probably benign Het
Bod1l G A 5: 41,832,231 A383V probably benign Het
Carmil3 GGACGA GGA 14: 55,499,476 probably benign Het
Cd200r3 T A 16: 44,954,189 D188E probably benign Het
Cd4 A T 6: 124,870,451 F250Y probably benign Het
Clcn4 T A 7: 7,287,814 Y662F probably benign Het
Cpa2 T C 6: 30,552,021 V249A probably benign Het
Depdc5 CTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCT CTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCT 5: 32,910,407 probably benign Het
Dhx57 A G 17: 80,275,082 Y365H probably damaging Het
Dsg1c A G 18: 20,275,265 E457G probably benign Het
Eef2k T A 7: 120,858,599 Y60* probably null Het
Efcc1 A G 6: 87,753,151 D482G probably null Het
Exoc4 C T 6: 33,277,244 R112C probably damaging Het
Fam178b A T 1: 36,600,525 D293E probably benign Het
Fbxl21 G A 13: 56,527,060 V49I probably damaging Het
Fyco1 A G 9: 123,838,888 V91A probably damaging Het
H2-M10.4 T C 17: 36,461,844 E82G probably damaging Het
Hmcn1 A G 1: 150,563,780 I5434T probably damaging Het
Incenp T C 19: 9,883,939 N450S unknown Het
Iqsec3 T C 6: 121,380,018 K1035E possibly damaging Het
Ltn1 A T 16: 87,426,286 V102D probably damaging Het
Mcur1 T C 13: 43,544,540 T295A probably damaging Het
Mpp5 A T 12: 78,824,837 D397V possibly damaging Het
Pcdha3 T C 18: 36,947,960 V585A probably damaging Het
Plcd4 A G 1: 74,563,468 T594A probably damaging Het
Ppp1r3c T C 19: 36,734,122 K83E probably damaging Het
Sesn3 C A 9: 14,322,658 T309K probably benign Het
Slc38a3 T C 9: 107,656,206 N251S probably benign Het
Sptbn4 A G 7: 27,367,702 V614A probably damaging Het
Srsf4 A G 4: 131,873,864 K34R probably damaging Het
Tfpi2 T C 6: 3,968,044 N32S possibly damaging Het
Ttll2 A T 17: 7,351,721 I269N probably benign Het
Utp3 T C 5: 88,555,599 V329A probably benign Het
Vmn2r102 A G 17: 19,694,713 T847A probably benign Het
Vmn2r70 A T 7: 85,565,333 W204R probably damaging Het
Xrcc3 A G 12: 111,804,532 L321P probably damaging Het
Other mutations in Hormad1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01653:Hormad1 APN 3 95578297 missense possibly damaging 0.49
IGL01686:Hormad1 APN 3 95578269 missense probably benign 0.02
IGL02023:Hormad1 APN 3 95578293 missense possibly damaging 0.91
B6584:Hormad1 UTSW 3 95570696 splice site probably benign
R0025:Hormad1 UTSW 3 95585125 unclassified probably benign
R0662:Hormad1 UTSW 3 95575599 missense probably benign 0.01
R0704:Hormad1 UTSW 3 95566686 critical splice donor site probably null
R1854:Hormad1 UTSW 3 95580006 missense probably benign 0.08
R2199:Hormad1 UTSW 3 95567722 critical splice donor site probably null
R2371:Hormad1 UTSW 3 95575599 missense probably benign 0.18
R2411:Hormad1 UTSW 3 95580015 missense probably benign 0.41
R3522:Hormad1 UTSW 3 95576285 missense probably benign 0.01
R4075:Hormad1 UTSW 3 95578203 missense possibly damaging 0.47
R4202:Hormad1 UTSW 3 95585198 missense probably benign 0.00
R4536:Hormad1 UTSW 3 95585141 missense probably benign 0.00
R4844:Hormad1 UTSW 3 95570931 missense probably damaging 0.98
R4903:Hormad1 UTSW 3 95585220 splice site probably null
R4964:Hormad1 UTSW 3 95585220 splice site probably null
R5135:Hormad1 UTSW 3 95585220 unclassified probably benign
R5208:Hormad1 UTSW 3 95578107 missense possibly damaging 0.46
R5372:Hormad1 UTSW 3 95576424 missense probably damaging 1.00
R5825:Hormad1 UTSW 3 95562559 missense probably damaging 0.97
R5895:Hormad1 UTSW 3 95559733 critical splice donor site probably null
R6124:Hormad1 UTSW 3 95576302 missense probably benign
R6453:Hormad1 UTSW 3 95578257 missense probably benign 0.02
R7308:Hormad1 UTSW 3 95562555 missense probably damaging 0.99
R7373:Hormad1 UTSW 3 95576317 missense probably damaging 1.00
X0025:Hormad1 UTSW 3 95581567 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTACAGGACTTCCAGAGAGATG -3'
(R):5'- AATGTTGACCACAGCTTTGAGG -3'

Sequencing Primer
(F):5'- GGACTTCCAGAGAGATGAAAGTATTC -3'
(R):5'- ACCACAGCTTTGAGGTATGTTC -3'
Posted On2017-12-01