Mutagenetix > Incidental Mutation

Incidental Mutation 'R4535:Depdc5'

500650

Institutional Source

Beutler Lab

Gene Symbol

Depdc5

Ensembl Gene

ENSMUSG00000037426

Gene Name

DEP domain containing 5

Synonyms

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4535 (G1)

Quality Score

191

Status

Not validated

Chromosome

Chromosomal Location

32863701-32994236 bp(+) (GRCm38)

Type of Mutation

critical splice acceptor site

DNA Base Change (assembly)

CTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCT to CTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCT at 32910407 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049780] [ENSMUST00000087897] [ENSMUST00000119705] [ENSMUST00000120902] [ENSMUST00000195980]

AlphaFold

P61460

Predicted Effect

probably benign
Transcript: ENSMUST00000049780

SMART Domains

Protein: ENSMUSP00000052807
Gene: ENSMUSG00000037426

Domain	Start	End	E-Value	Type
Pfam:DUF3608	100	382	3.7e-64	PFAM
low complexity region	491	508	N/A	INTRINSIC
low complexity region	656	667	N/A	INTRINSIC
low complexity region	690	699	N/A	INTRINSIC
low complexity region	817	827	N/A	INTRINSIC
low complexity region	985	997	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000087897

SMART Domains

Protein: ENSMUSP00000085207
Gene: ENSMUSG00000037426

Domain	Start	End	E-Value	Type
Pfam:DUF3608	100	382	2.3e-63	PFAM
low complexity region	491	508	N/A	INTRINSIC
low complexity region	656	667	N/A	INTRINSIC
low complexity region	690	699	N/A	INTRINSIC
low complexity region	826	836	N/A	INTRINSIC
low complexity region	994	1006	N/A	INTRINSIC
low complexity region	1159	1175	N/A	INTRINSIC
DEP	1184	1259	2.49e-15	SMART
low complexity region	1322	1335	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000119705

SMART Domains

Protein: ENSMUSP00000113862
Gene: ENSMUSG00000037426

Domain	Start	End	E-Value	Type
Pfam:DUF3608	100	382	3e-117	PFAM
low complexity region	491	508	N/A	INTRINSIC
low complexity region	656	667	N/A	INTRINSIC
low complexity region	690	699	N/A	INTRINSIC
low complexity region	817	827	N/A	INTRINSIC
low complexity region	985	997	N/A	INTRINSIC
low complexity region	1150	1166	N/A	INTRINSIC
DEP	1175	1250	2.49e-15	SMART
low complexity region	1313	1326	N/A	INTRINSIC
low complexity region	1511	1525	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000120902

SMART Domains

Protein: ENSMUSP00000113980
Gene: ENSMUSG00000037426

Domain	Start	End	E-Value	Type
Pfam:DUF3608	100	382	3.7e-63	PFAM
low complexity region	491	508	N/A	INTRINSIC
low complexity region	656	667	N/A	INTRINSIC
low complexity region	690	699	N/A	INTRINSIC
low complexity region	817	827	N/A	INTRINSIC
low complexity region	985	997	N/A	INTRINSIC
low complexity region	1128	1144	N/A	INTRINSIC
DEP	1153	1228	2.49e-15	SMART
low complexity region	1291	1304	N/A	INTRINSIC
low complexity region	1489	1503	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139098

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000158455

Predicted Effect

probably benign
Transcript: ENSMUST00000195980

SMART Domains

Protein: ENSMUSP00000143228
Gene: ENSMUSG00000037426

Domain	Start	End	E-Value	Type
Pfam:DUF3608	100	147	4e-7	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000201802

Predicted Effect

probably benign
Transcript: ENSMUST00000201836

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the IML1 family of proteins involved in G-protein signaling pathways. The mechanistic target of rapamycin complex 1 (mTORC1) pathway regulates cell growth by sensing the availability of nutrients. The protein encoded by this gene is a component of the GATOR1 (GAP activity toward Rags) complex which inhibits the amino acid-sensing branch of the mTORC1 pathway. Mutations in this gene are associated with autosomal dominant familial focal epilepsy with variable foci. A single nucleotide polymorphism in an intron of this gene has been associated with an increased risk of hepatocellular carcinoma in individuals with chronic hepatitis C virus infection. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit preweaning lethality. Mice homozygous for a conditional allele activated in neurons exhibit reduced body weight, limb grasping, premature death, spontaneous seizure, increased brain size due to neuron hypertrophy and increased PTZ seizure susceptibility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arhgef4	T	C	1: 34,723,081	S473P	unknown	Het
Azin1	A	T	15: 38,493,605	I258N	probably benign	Het
Bod1l	G	A	5: 41,832,231	A383V	probably benign	Het
Carmil3	GGACGA	GGA	14: 55,499,476		probably benign	Het
Cd200r3	T	A	16: 44,954,189	D188E	probably benign	Het
Cd4	A	T	6: 124,870,451	F250Y	probably benign	Het
Clcn4	T	A	7: 7,287,814	Y662F	probably benign	Het
Cpa2	T	C	6: 30,552,021	V249A	probably benign	Het
Dhx57	A	G	17: 80,275,082	Y365H	probably damaging	Het
Dsg1c	A	G	18: 20,275,265	E457G	probably benign	Het
Eef2k	T	A	7: 120,858,599	Y60*	probably null	Het
Efcc1	A	G	6: 87,753,151	D482G	probably null	Het
Exoc4	C	T	6: 33,277,244	R112C	probably damaging	Het
Fam178b	A	T	1: 36,600,525	D293E	probably benign	Het
Fbxl21	G	A	13: 56,527,060	V49I	probably damaging	Het
Fyco1	A	G	9: 123,838,888	V91A	probably damaging	Het
H2-M10.4	T	C	17: 36,461,844	E82G	probably damaging	Het
Hmcn1	A	G	1: 150,563,780	I5434T	probably damaging	Het
Hormad1	T	C	3: 95,585,141	V343A	probably benign	Het
Incenp	T	C	19: 9,883,939	N450S	unknown	Het
Iqsec3	T	C	6: 121,380,018	K1035E	possibly damaging	Het
Ltn1	A	T	16: 87,426,286	V102D	probably damaging	Het
Mcur1	T	C	13: 43,544,540	T295A	probably damaging	Het
Mpp5	A	T	12: 78,824,837	D397V	possibly damaging	Het
Pcdha3	T	C	18: 36,947,960	V585A	probably damaging	Het
Plcd4	A	G	1: 74,563,468	T594A	probably damaging	Het
Ppp1r3c	T	C	19: 36,734,122	K83E	probably damaging	Het
Sesn3	C	A	9: 14,322,658	T309K	probably benign	Het
Slc38a3	T	C	9: 107,656,206	N251S	probably benign	Het
Sptbn4	A	G	7: 27,367,702	V614A	probably damaging	Het
Srsf4	A	G	4: 131,873,864	K34R	probably damaging	Het
Tfpi2	T	C	6: 3,968,044	N32S	possibly damaging	Het
Ttll2	A	T	17: 7,351,721	I269N	probably benign	Het
Utp3	T	C	5: 88,555,599	V329A	probably benign	Het
Vmn2r102	A	G	17: 19,694,713	T847A	probably benign	Het
Vmn2r70	A	T	7: 85,565,333	W204R	probably damaging	Het
Xrcc3	A	G	12: 111,804,532	L321P	probably damaging	Het

Other mutations in Depdc5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00861:Depdc5	APN	5	32967814	splice site	probably null
IGL01019:Depdc5	APN	5	32893401	missense	probably damaging	0.96
IGL01067:Depdc5	APN	5	32899067	splice site	probably null
IGL01405:Depdc5	APN	5	32937689	missense	possibly damaging	0.90
IGL01577:Depdc5	APN	5	32955897	missense	possibly damaging	0.49
IGL01633:Depdc5	APN	5	32924200	missense	probably damaging	1.00
IGL01998:Depdc5	APN	5	32945151	splice site	probably benign
IGL02025:Depdc5	APN	5	32946632	critical splice acceptor site	probably null
IGL02167:Depdc5	APN	5	32903801	missense	probably damaging	1.00
IGL02537:Depdc5	APN	5	32967787	missense	probably damaging	1.00
IGL02812:Depdc5	APN	5	32893368	splice site	probably benign
IGL03001:Depdc5	APN	5	32945090	missense	possibly damaging	0.74
IGL03253:Depdc5	APN	5	32868813	unclassified	probably benign
alligator	UTSW	5	32964507	splice site	probably null
lagarto	UTSW	5	32979508	missense	probably damaging	1.00
sauros	UTSW	5	32986966	missense	possibly damaging	0.92
IGL02988:Depdc5	UTSW	5	32956167	splice site	probably null
R0038:Depdc5	UTSW	5	32868853	missense	probably benign	0.01
R0038:Depdc5	UTSW	5	32868853	missense	probably benign	0.01
R0153:Depdc5	UTSW	5	32933937	splice site	probably benign
R0179:Depdc5	UTSW	5	32901574	unclassified	probably benign
R0212:Depdc5	UTSW	5	32912242	missense	probably benign	0.00
R0239:Depdc5	UTSW	5	32943240	missense	probably damaging	1.00
R0239:Depdc5	UTSW	5	32943240	missense	probably damaging	1.00
R0302:Depdc5	UTSW	5	32904546	critical splice donor site	probably benign
R0511:Depdc5	UTSW	5	32945028	nonsense	probably null
R0677:Depdc5	UTSW	5	32901470	missense	probably damaging	1.00
R0884:Depdc5	UTSW	5	32917978	missense	possibly damaging	0.94
R0973:Depdc5	UTSW	5	32986966	missense	possibly damaging	0.92
R1314:Depdc5	UTSW	5	32877074	missense	probably damaging	1.00
R1611:Depdc5	UTSW	5	32990953	missense	probably damaging	1.00
R1687:Depdc5	UTSW	5	32910407	critical splice acceptor site	probably benign
R1748:Depdc5	UTSW	5	32917942	missense	probably benign	0.24
R1903:Depdc5	UTSW	5	32910407	critical splice acceptor site	probably benign
R1956:Depdc5	UTSW	5	32903831	missense	probably damaging	1.00
R1997:Depdc5	UTSW	5	32901906	critical splice donor site	probably null
R2079:Depdc5	UTSW	5	32946674	missense	possibly damaging	0.75
R2131:Depdc5	UTSW	5	32990781	nonsense	probably null
R2291:Depdc5	UTSW	5	32979402	missense	probably damaging	1.00
R2422:Depdc5	UTSW	5	32991035	missense	probably damaging	1.00
R2851:Depdc5	UTSW	5	32924171	missense	probably damaging	0.96
R2852:Depdc5	UTSW	5	32924171	missense	probably damaging	0.96
R2937:Depdc5	UTSW	5	32901621	splice site	probably null
R2938:Depdc5	UTSW	5	32901621	splice site	probably null
R2974:Depdc5	UTSW	5	32934017	critical splice donor site	probably null
R3884:Depdc5	UTSW	5	32944077	missense	probably damaging	1.00
R3967:Depdc5	UTSW	5	32944115	nonsense	probably null
R4118:Depdc5	UTSW	5	32964635	missense	probably damaging	1.00
R4197:Depdc5	UTSW	5	32991203	missense	possibly damaging	0.93
R4407:Depdc5	UTSW	5	32904534	critical splice donor site	probably null
R4534:Depdc5	UTSW	5	32910407	critical splice acceptor site	probably benign
R4538:Depdc5	UTSW	5	32983946	missense	probably damaging	1.00
R4613:Depdc5	UTSW	5	32975446	missense	probably damaging	1.00
R4736:Depdc5	UTSW	5	32975322	missense	probably benign
R4738:Depdc5	UTSW	5	32975322	missense	probably benign
R4765:Depdc5	UTSW	5	32937635	missense	probably damaging	1.00
R5021:Depdc5	UTSW	5	32979414	missense	probably damaging	1.00
R5259:Depdc5	UTSW	5	32938291	missense	probably damaging	1.00
R5261:Depdc5	UTSW	5	32938291	missense	probably damaging	1.00
R5541:Depdc5	UTSW	5	32864629	utr 5 prime	probably benign
R5594:Depdc5	UTSW	5	32901490	missense	possibly damaging	0.46
R5929:Depdc5	UTSW	5	32975506	nonsense	probably null
R6132:Depdc5	UTSW	5	32910467	missense	probably damaging	0.99
R6146:Depdc5	UTSW	5	32968731	missense	probably benign	0.01
R6336:Depdc5	UTSW	5	32964507	splice site	probably null
R6468:Depdc5	UTSW	5	32912231	missense	probably benign	0.02
R6911:Depdc5	UTSW	5	32924192	missense	probably damaging	1.00
R6969:Depdc5	UTSW	5	32983860	missense	probably damaging	1.00
R7002:Depdc5	UTSW	5	32877158	splice site	probably null
R7066:Depdc5	UTSW	5	32901848	missense	probably benign	0.08
R7231:Depdc5	UTSW	5	32901865	missense	possibly damaging	0.92
R7264:Depdc5	UTSW	5	32967745	missense	probably benign
R7302:Depdc5	UTSW	5	32979508	missense	probably damaging	1.00
R7386:Depdc5	UTSW	5	32927936	missense	probably benign
R7564:Depdc5	UTSW	5	32901510	missense	probably damaging	1.00
R7636:Depdc5	UTSW	5	32917983	missense	probably benign
R7795:Depdc5	UTSW	5	32944103	missense	probably damaging	1.00
R7845:Depdc5	UTSW	5	32903915	splice site	probably null
R8013:Depdc5	UTSW	5	32973842	missense	probably benign	0.01
R8037:Depdc5	UTSW	5	32959348	critical splice donor site	probably null
R8038:Depdc5	UTSW	5	32959348	critical splice donor site	probably null
R8065:Depdc5	UTSW	5	32895908	missense	possibly damaging	0.89
R8067:Depdc5	UTSW	5	32895908	missense	possibly damaging	0.89
R8108:Depdc5	UTSW	5	32945049	missense	probably benign	0.01
R8112:Depdc5	UTSW	5	32968706	missense	possibly damaging	0.67
R8213:Depdc5	UTSW	5	32937637	missense	probably damaging	1.00
R8382:Depdc5	UTSW	5	32927898	missense	probably benign	0.00
R8680:Depdc5	UTSW	5	32944038	missense	possibly damaging	0.48
R8743:Depdc5	UTSW	5	32924243	missense	probably benign	0.10
R8754:Depdc5	UTSW	5	32979537	missense	probably benign	0.00
R9157:Depdc5	UTSW	5	32945108	missense	probably damaging	0.98
R9364:Depdc5	UTSW	5	32964732	missense	probably benign
R9441:Depdc5	UTSW	5	32937698	missense	probably benign	0.03
R9450:Depdc5	UTSW	5	32934010	missense	probably benign
R9459:Depdc5	UTSW	5	32990773	missense	probably damaging	0.99
R9554:Depdc5	UTSW	5	32964732	missense	probably benign
R9569:Depdc5	UTSW	5	32867977	missense	probably damaging	0.98
R9647:Depdc5	UTSW	5	32924223	missense	possibly damaging	0.94
R9688:Depdc5	UTSW	5	32897932	nonsense	probably null
X0027:Depdc5	UTSW	5	32904292	missense	probably damaging	1.00
Z1176:Depdc5	UTSW	5	32943282	missense	possibly damaging	0.87

Predicted Primers

PCR Primer
(F):5'- GCAGTTTGCCTTAAGGTTTAGC -3'
(R):5'- CAGAATAAATACACAGCTGGGTGAC -3'

Sequencing Primer
(F):5'- GGTATACTAGGGGCCAACTTTATCC -3'
(R):5'- TCCGTGGAGTGAAACTGT -3'

Posted On

2017-12-01