Incidental Mutation 'R4536:Hormad1'
ID500651
Institutional Source Beutler Lab
Gene Symbol Hormad1
Ensembl Gene ENSMUSG00000028109
Gene NameHORMA domain containing 1
SynonymsNohma, 4921522K05Rik
Accession Numbers

Genbank: NM_026489.2; Ensembl: ENSMUST00000107154, ENSMUST00000090797, ENSMUST00000029754, ENSMUST00000171191

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4536 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location95559677-95587671 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 95585141 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 343 (V343A)
Ref Sequence ENSEMBL: ENSMUSP00000102772 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029754] [ENSMUST00000060323] [ENSMUST00000090797] [ENSMUST00000098861] [ENSMUST00000107154] [ENSMUST00000171191] [ENSMUST00000177390]
Predicted Effect probably benign
Transcript: ENSMUST00000029754
AA Change: V343A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000029754
Gene: ENSMUSG00000028109
AA Change: V343A

DomainStartEndE-ValueType
Pfam:HORMA 24 221 4.7e-63 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000060323
SMART Domains Protein: ENSMUSP00000058654
Gene: ENSMUSG00000046519

DomainStartEndE-ValueType
Pfam:GPP34 50 275 8.5e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000090797
AA Change: V343A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000088303
Gene: ENSMUSG00000028109
AA Change: V343A

DomainStartEndE-ValueType
Pfam:HORMA 23 221 5.4e-60 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000098861
SMART Domains Protein: ENSMUSP00000096460
Gene: ENSMUSG00000046519

DomainStartEndE-ValueType
low complexity region 58 69 N/A INTRINSIC
low complexity region 72 83 N/A INTRINSIC
Pfam:GPP34 106 277 5.1e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107154
AA Change: V343A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000102772
Gene: ENSMUSG00000028109
AA Change: V343A

DomainStartEndE-ValueType
Pfam:HORMA 23 221 5.4e-60 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171191
AA Change: V343A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000127180
Gene: ENSMUSG00000028109
AA Change: V343A

DomainStartEndE-ValueType
Pfam:HORMA 23 221 5.4e-60 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176541
Predicted Effect probably benign
Transcript: ENSMUST00000176674
SMART Domains Protein: ENSMUSP00000134885
Gene: ENSMUSG00000046519

DomainStartEndE-ValueType
low complexity region 58 69 N/A INTRINSIC
low complexity region 72 83 N/A INTRINSIC
Pfam:GPP34 104 288 2.4e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176755
SMART Domains Protein: ENSMUSP00000134804
Gene: ENSMUSG00000046519

DomainStartEndE-ValueType
low complexity region 56 67 N/A INTRINSIC
low complexity region 70 81 N/A INTRINSIC
Pfam:GPP34 104 275 7.5e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177389
Predicted Effect probably benign
Transcript: ENSMUST00000177390
SMART Domains Protein: ENSMUSP00000134799
Gene: ENSMUSG00000046519

DomainStartEndE-ValueType
low complexity region 58 69 N/A INTRINSIC
low complexity region 72 83 N/A INTRINSIC
Pfam:GPP34 106 332 8.3e-61 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177399
SMART Domains Protein: ENSMUSP00000134998
Gene: ENSMUSG00000046519

DomainStartEndE-ValueType
Pfam:GPP34 23 170 5.4e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198013
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a HORMA domain-containing protein. HORMA domains are involved in chromatin binding and play a role in cell cycle regulation. The encoded protein may play a role in meiosis, and expression of this gene is a potential marker for cancer. A pseudogene of this gene is located on the long arm of chromosome 6. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2010]
PHENOTYPE: Homozgous mice are infertile because of meiosis arrest associated with impaired synaptonemal-complex formation. [provided by MGI curators]
Allele List at MGI

All alleles(9) : Targeted, knock-out(1) Targeted, other(1) Gene trapped(7)

Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Amot A G X: 145,480,142 S398P probably benign Het
Arhgef17 G C 7: 100,929,854 S629C probably damaging Het
Atp8b2 G A 3: 89,941,784 A1081V probably benign Het
Atpif1 A C 4: 132,533,559 S4A possibly damaging Het
Atr A G 9: 95,874,418 D867G probably benign Het
C1qtnf3 G A 15: 10,972,027 S206N probably damaging Het
Cep152 A C 2: 125,602,947 probably null Het
Cetn1 T C 18: 9,618,998 E141G probably damaging Het
Erbb4 A T 1: 68,346,622 N269K probably damaging Het
Exoc4 C T 6: 33,277,244 R112C probably damaging Het
Frmd4b T A 6: 97,310,732 Q241L possibly damaging Het
Fyco1 A G 9: 123,838,888 V91A probably damaging Het
Gls2 G A 10: 128,200,937 V196I probably benign Het
Gm15448 T A 7: 3,822,252 M464L probably benign Het
Gm5426 G A 10: 96,136,702 A34T probably benign Het
Incenp T C 19: 9,883,939 N450S unknown Het
Klhl1 A C 14: 96,136,583 probably null Het
Mettl4 C A 17: 94,735,505 S301I possibly damaging Het
Mlxip G A 5: 123,450,503 D819N probably damaging Het
Olfr975 A T 9: 39,950,435 L112Q probably damaging Het
Pam T A 1: 97,844,699 K440* probably null Het
Phldb2 T C 16: 45,770,681 M996V probably benign Het
Rad51ap2 A G 12: 11,457,849 S591G possibly damaging Het
Rfx6 A G 10: 51,723,784 N542S probably benign Het
Slc44a4 T A 17: 34,923,839 C254S probably damaging Het
Sptbn2 C T 19: 4,732,602 A522V probably damaging Het
St5 A T 7: 109,531,156 S879R probably damaging Het
Syt10 C T 15: 89,782,622 D509N probably damaging Het
Tango2 A G 16: 18,324,355 probably null Het
Tfpi2 T C 6: 3,968,044 N32S possibly damaging Het
Trafd1 T C 5: 121,379,683 probably null Het
Ttll2 A T 17: 7,351,721 I269N probably benign Het
Tysnd1 G A 10: 61,696,053 W161* probably null Het
Uggt2 A T 14: 119,019,558 M1088K probably benign Het
Other mutations in Hormad1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01653:Hormad1 APN 3 95578297 missense possibly damaging 0.49
IGL01686:Hormad1 APN 3 95578269 missense probably benign 0.02
IGL02023:Hormad1 APN 3 95578293 missense possibly damaging 0.91
B6584:Hormad1 UTSW 3 95570696 splice site probably benign
R0025:Hormad1 UTSW 3 95585125 unclassified probably benign
R0662:Hormad1 UTSW 3 95575599 missense probably benign 0.01
R0704:Hormad1 UTSW 3 95566686 critical splice donor site probably null
R1854:Hormad1 UTSW 3 95580006 missense probably benign 0.08
R2199:Hormad1 UTSW 3 95567722 critical splice donor site probably null
R2371:Hormad1 UTSW 3 95575599 missense probably benign 0.18
R2411:Hormad1 UTSW 3 95580015 missense probably benign 0.41
R3522:Hormad1 UTSW 3 95576285 missense probably benign 0.01
R4075:Hormad1 UTSW 3 95578203 missense possibly damaging 0.47
R4202:Hormad1 UTSW 3 95585198 missense probably benign 0.00
R4535:Hormad1 UTSW 3 95585141 missense probably benign 0.00
R4844:Hormad1 UTSW 3 95570931 missense probably damaging 0.98
R4903:Hormad1 UTSW 3 95585220 splice site probably null
R4964:Hormad1 UTSW 3 95585220 splice site probably null
R5135:Hormad1 UTSW 3 95585220 unclassified probably benign
R5208:Hormad1 UTSW 3 95578107 missense possibly damaging 0.46
R5372:Hormad1 UTSW 3 95576424 missense probably damaging 1.00
R5825:Hormad1 UTSW 3 95562559 missense probably damaging 0.97
R5895:Hormad1 UTSW 3 95559733 critical splice donor site probably null
R6124:Hormad1 UTSW 3 95576302 missense probably benign
R6453:Hormad1 UTSW 3 95578257 missense probably benign 0.02
R7308:Hormad1 UTSW 3 95562555 missense probably damaging 0.99
R7373:Hormad1 UTSW 3 95576317 missense probably damaging 1.00
X0025:Hormad1 UTSW 3 95581567 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTACAGGACTTCCAGAGAGATG -3'
(R):5'- GGAATGTTGACCACAGCTTTGAG -3'

Sequencing Primer
(F):5'- GGACTTCCAGAGAGATGAAAGTATTC -3'
(R):5'- ACCACAGCTTTGAGGTATGTTC -3'
Posted On2017-12-01