Incidental Mutation 'R4522:Spem1'
ID500662
Institutional Source Beutler Lab
Gene Symbol Spem1
Ensembl Gene ENSMUSG00000041165
Gene Namesperm maturation 1
Synonyms
MMRRC Submission 041765-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.145) question?
Stock #R4522 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location69820876-69822180 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to A at 69821805 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000037500 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045771] [ENSMUST00000045771] [ENSMUST00000056484] [ENSMUST00000056941] [ENSMUST00000108634]
Predicted Effect probably null
Transcript: ENSMUST00000045771
SMART Domains Protein: ENSMUSP00000037500
Gene: ENSMUSG00000041165

DomainStartEndE-ValueType
Pfam:Spem1 12 196 3.7e-23 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000045771
SMART Domains Protein: ENSMUSP00000037500
Gene: ENSMUSG00000041165

DomainStartEndE-ValueType
Pfam:Spem1 12 196 3.7e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000056484
SMART Domains Protein: ENSMUSP00000053097
Gene: ENSMUSG00000051790

DomainStartEndE-ValueType
Pfam:COesterase 31 601 1.6e-199 PFAM
Pfam:Abhydrolase_3 180 372 4.8e-9 PFAM
low complexity region 630 652 N/A INTRINSIC
transmembrane domain 678 700 N/A INTRINSIC
low complexity region 702 712 N/A INTRINSIC
low complexity region 713 731 N/A INTRINSIC
low complexity region 782 823 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000056941
SMART Domains Protein: ENSMUSP00000051204
Gene: ENSMUSG00000044084

DomainStartEndE-ValueType
Pfam:Spem1 1 261 2e-121 PFAM
low complexity region 281 294 N/A INTRINSIC
low complexity region 478 494 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108634
SMART Domains Protein: ENSMUSP00000104274
Gene: ENSMUSG00000051790

DomainStartEndE-ValueType
Pfam:COesterase 30 601 2e-186 PFAM
Pfam:Abhydrolase_3 180 327 3.3e-9 PFAM
low complexity region 630 652 N/A INTRINSIC
transmembrane domain 678 700 N/A INTRINSIC
low complexity region 702 712 N/A INTRINSIC
low complexity region 713 731 N/A INTRINSIC
low complexity region 782 823 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Male mice homozygous for a null allele display infertility, asthenozoospermia, teratozoospermia, and impaired spermiogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ascc3 A G 10: 50,660,670 N700D probably benign Het
Babam2 G A 5: 32,007,242 V287M probably damaging Het
Brip1 T C 11: 86,189,801 I146M possibly damaging Het
Cacna1b C T 2: 24,654,430 R1248H probably damaging Het
Ccdc88c G T 12: 100,913,332 S1843R possibly damaging Het
Chaf1b G A 16: 93,901,295 A485T probably benign Het
Dock7 T C 4: 98,962,224 R1594G probably damaging Het
Fam122c G A X: 53,293,499 R94H possibly damaging Het
Fbxo41 A G 6: 85,484,042 I228T probably damaging Het
Gm3739 T A 14: 7,299,398 K86* probably null Het
Gm7173 A T X: 79,509,995 N291K possibly damaging Het
Mark2 A T 19: 7,285,948 D151E probably damaging Het
Nop2 G T 6: 125,133,552 R47L probably damaging Het
Nwd1 A T 8: 72,670,951 D606V probably damaging Het
Olfr1132 T A 2: 87,635,151 I199L probably benign Het
Pcbp1 T C 6: 86,525,050 N289S probably benign Het
Plce1 T C 19: 38,524,319 S21P possibly damaging Het
Ptpn18 T C 1: 34,472,960 L55P probably benign Het
Rpl10l T C 12: 66,283,738 D207G probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sec23b T A 2: 144,578,366 I450N possibly damaging Het
Speg A G 1: 75,428,330 E2922G probably damaging Het
Stxbp3-ps A T 19: 9,559,110 noncoding transcript Het
Tmem38a C T 8: 72,572,161 P20S possibly damaging Het
Tmod2 T C 9: 75,592,584 T129A probably benign Het
Ttc28 A G 5: 111,280,172 T1845A probably benign Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Ush2a C T 1: 188,864,625 T3854M probably damaging Het
Vmn2r72 T A 7: 85,751,926 H95L probably benign Het
Xdh C A 17: 73,898,344 G1042V probably damaging Het
Zfp105 T A 9: 122,930,056 V264E possibly damaging Het
Other mutations in Spem1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00902:Spem1 APN 11 69821817 missense probably damaging 1.00
R0118:Spem1 UTSW 11 69821545 missense possibly damaging 0.92
R0487:Spem1 UTSW 11 69821865 critical splice acceptor site probably null
R0734:Spem1 UTSW 11 69821271 missense probably damaging 1.00
R2483:Spem1 UTSW 11 69821518 missense possibly damaging 0.95
R4866:Spem1 UTSW 11 69820929 missense probably damaging 1.00
R5297:Spem1 UTSW 11 69820927 missense probably damaging 1.00
R5404:Spem1 UTSW 11 69820937 missense probably damaging 1.00
R5672:Spem1 UTSW 11 69821437 missense probably damaging 1.00
R5989:Spem1 UTSW 11 69821125 missense possibly damaging 0.65
R6803:Spem1 UTSW 11 69821148 missense possibly damaging 0.84
R7234:Spem1 UTSW 11 69821804 critical splice donor site probably null
R7631:Spem1 UTSW 11 69821583 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TAGGTCTGCTTCCTCAAGGG -3'
(R):5'- ACATTGGCATCAATTTGGTGACC -3'

Sequencing Primer
(F):5'- CAGCTTCCCAAGTGAAGTACTGG -3'
(R):5'- GCATCAATTTGGTGACCCTGGTC -3'
Posted On2017-12-01