Mutagenetix > Incidental Mutations

Incidental Mutation 'R4522:Stxbp3-ps'

500663

Institutional Source

Beutler Lab

Gene Symbol

Stxbp3-ps

Ensembl Gene

ENSMUSG00000071640

Gene Name

syntaxin-binding protein 3, pseudogene

Synonyms

Munc18c(L), Stxbp3b

MMRRC Submission

041765-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.246) question?

Stock #

R4522 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

9557792-9559183 bp(-) (GRCm38)

Type of Mutation

critical splice donor site

DNA Base Change (assembly)

A to T at 9559110 bp

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s):

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000090527

SMART Domains

Protein: ENSMUSP00000088014
Gene: ENSMUSG00000071640

Domain	Start	End	E-Value	Type
Pfam:Sec1	33	253	1.2e-48	PFAM

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.1%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 31 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ascc3	A	G	10: 50,660,670	N700D	probably benign	Het
Babam2	G	A	5: 32,007,242	V287M	probably damaging	Het
Brip1	T	C	11: 86,189,801	I146M	possibly damaging	Het
Cacna1b	C	T	2: 24,654,430	R1248H	probably damaging	Het
Ccdc88c	G	T	12: 100,913,332	S1843R	possibly damaging	Het
Chaf1b	G	A	16: 93,901,295	A485T	probably benign	Het
Dock7	T	C	4: 98,962,224	R1594G	probably damaging	Het
Fam122c	G	A	X: 53,293,499	R94H	possibly damaging	Het
Fbxo41	A	G	6: 85,484,042	I228T	probably damaging	Het
Gm3739	T	A	14: 7,299,398	K86*	probably null	Het
Gm7173	A	T	X: 79,509,995	N291K	possibly damaging	Het
Mark2	A	T	19: 7,285,948	D151E	probably damaging	Het
Nop2	G	T	6: 125,133,552	R47L	probably damaging	Het
Nwd1	A	T	8: 72,670,951	D606V	probably damaging	Het
Olfr1132	T	A	2: 87,635,151	I199L	probably benign	Het
Pcbp1	T	C	6: 86,525,050	N289S	probably benign	Het
Plce1	T	C	19: 38,524,319	S21P	possibly damaging	Het
Ptpn18	T	C	1: 34,472,960	L55P	probably benign	Het
Rpl10l	T	C	12: 66,283,738	D207G	probably benign	Het
Rufy4	T	C	1: 74,147,663	C537R	probably damaging	Het
Sec23b	T	A	2: 144,578,366	I450N	possibly damaging	Het
Speg	A	G	1: 75,428,330	E2922G	probably damaging	Het
Spem1	C	A	11: 69,821,805		probably null	Het
Tmem38a	C	T	8: 72,572,161	P20S	possibly damaging	Het
Tmod2	T	C	9: 75,592,584	T129A	probably benign	Het
Ttc28	A	G	5: 111,280,172	T1845A	probably benign	Het
Ubqlnl	C	T	7: 104,149,718	V191M	probably benign	Het
Ush2a	C	T	1: 188,864,625	T3854M	probably damaging	Het
Vmn2r72	T	A	7: 85,751,926	H95L	probably benign	Het
Xdh	C	A	17: 73,898,344	G1042V	probably damaging	Het
Zfp105	T	A	9: 122,930,056	V264E	possibly damaging	Het

Other mutations in Stxbp3-ps

Allele	Source	Chr	Coord	Type	Predicted Effect
IGL00569:Stxbp3-ps	APN	19	9557822	exon	noncoding transcript
IGL01296:Stxbp3-ps	APN	19	9557892	exon	noncoding transcript
IGL01455:Stxbp3-ps	APN	19	9558007	exon	noncoding transcript
IGL02698:Stxbp3-ps	APN	19	9558324	exon	noncoding transcript
IGL02756:Stxbp3-ps	APN	19	9557829	exon	noncoding transcript
IGL03324:Stxbp3-ps	APN	19	9558350	exon	noncoding transcript
R0217:Stxbp3-ps	UTSW	19	9559132	exon	noncoding transcript
R5030:Stxbp3-ps	UTSW	19	9558350	exon	noncoding transcript
R5541:Stxbp3-ps	UTSW	19	9557970	exon	noncoding transcript

Predicted Primers

PCR Primer
(F):5'- TTCTGCTGACATGTAATCTTTCTG -3'
(R):5'- AGCTGCAGTCAGTAAAACACT -3'

Sequencing Primer
(F):5'- TCTGTTAATGAATCAAACCCGTGCC -3'
(R):5'- TATTAGAAACATCATTACCAGGGGGC -3'

Posted On

2017-12-01