Incidental Mutation 'R4601:Gif'
ID500684
Institutional Source Beutler Lab
Gene Symbol Gif
Ensembl Gene ENSMUSG00000024682
Gene Namegastric intrinsic factor
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4601 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location11747554-11763447 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 11752190 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 171 (D171A)
Ref Sequence ENSEMBL: ENSMUSP00000025585 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025585]
Predicted Effect probably damaging
Transcript: ENSMUST00000025585
AA Change: D171A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000025585
Gene: ENSMUSG00000024682
AA Change: D171A

DomainStartEndE-ValueType
Pfam:Cobalamin_bind 8 308 2.6e-110 PFAM
Pfam:DUF4430 340 416 7.7e-9 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the cobalamin transport protein family. It encodes a glycoprotein secreted by parietal cells of the gastric mucosa and is required for adequate absorption of vitamin B12. Vitamin B12 is necessary for erythrocyte maturation and mutations in this gene may lead to congenital pernicious anemia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit vitamin B12-sensitive susceptibility to bacterial infection and reduced body weight and altered blood chemistry that can be compensated by maternal effect. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029J07Rik A T 8: 45,970,468 I69N probably damaging Het
4930435E12Rik A G 16: 38,828,018 V243A probably benign Het
Aars2 T A 17: 45,516,921 D555E probably damaging Het
Abca16 T G 7: 120,436,697 F334L probably damaging Het
Abcc4 T A 14: 118,632,163 M186L probably benign Het
Agap3 T C 5: 24,476,408 L120P probably damaging Het
Ak7 G A 12: 105,713,575 V123M probably benign Het
Aldh1a7 A T 19: 20,715,979 V192D probably damaging Het
Ankrd36 A G 11: 5,570,102 D59G probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Cacna1e A G 1: 154,471,613 V936A probably benign Het
Camkv T C 9: 107,946,096 V107A probably damaging Het
Camp T C 9: 109,848,662 E80G probably damaging Het
Ccdc66 T C 14: 27,500,420 N122S probably damaging Het
Cd101 G A 3: 100,993,888 T960M possibly damaging Het
Cdk18 A G 1: 132,116,919 V323A possibly damaging Het
Celf2 G T 2: 6,586,020 N279K possibly damaging Het
Cemip T C 7: 83,951,618 I932V probably damaging Het
Cep250 C A 2: 155,962,053 Q28K probably benign Het
Ces2f T C 8: 104,949,964 C97R probably damaging Het
Cfap126 G T 1: 171,114,058 G41C possibly damaging Het
Chat T C 14: 32,424,155 M354V probably benign Het
Clca4b A T 3: 144,927,184 D168E possibly damaging Het
Cpxm1 T A 2: 130,393,576 M499L possibly damaging Het
Dennd3 T A 15: 73,567,160 W1126R probably damaging Het
Dgkb T C 12: 38,602,820 S735P probably damaging Het
Dlec1 T C 9: 119,147,134 probably null Het
Dnajc6 T C 4: 101,611,264 F166L probably damaging Het
Dph5 A G 3: 115,899,777 N115D possibly damaging Het
Ercc3 G A 18: 32,245,571 A202T probably benign Het
Erich3 A T 3: 154,764,738 D136V unknown Het
Exoc2 T C 13: 30,882,268 N475S probably benign Het
Fam160a1 T C 3: 85,741,180 M26V probably damaging Het
Fam217a T C 13: 34,911,302 D310G probably damaging Het
Fam53a C T 5: 33,600,663 S372N probably benign Het
Fbn2 C G 18: 58,053,733 G1699R probably damaging Het
Fbxo46 T C 7: 19,135,564 V36A probably benign Het
G6pc A G 11: 101,372,741 Y127C probably damaging Het
Gba2 A G 4: 43,573,810 F161L probably damaging Het
Gja1 T C 10: 56,388,229 L228P probably damaging Het
Gm20834 A G Y: 10,323,178 V86A probably benign Het
Hmcn1 A T 1: 150,738,645 C1337S probably damaging Het
Il1rl1 T A 1: 40,441,300 S30T possibly damaging Het
Itgb4 A G 11: 116,005,722 T1436A probably damaging Het
Itk T A 11: 46,336,515 Q427L probably benign Het
Klhdc4 T C 8: 121,799,527 E291G probably damaging Het
Map4 T A 9: 110,052,819 S250R possibly damaging Het
Mnt T A 11: 74,836,459 V57E possibly damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Musk A T 4: 58,301,625 I128F probably damaging Het
Myh4 G A 11: 67,250,310 A733T possibly damaging Het
Myo5a T A 9: 75,136,388 F220I probably damaging Het
Npas3 A G 12: 54,044,578 H305R probably damaging Het
Nrcam A T 12: 44,591,056 Y1132F probably damaging Het
Nt5c3b A C 11: 100,432,918 D189E probably benign Het
Nuf2 A G 1: 169,506,114 L331P probably damaging Het
Nup214 C T 2: 31,997,965 T646I probably benign Het
Olfr112 T C 17: 37,564,185 N42S probably damaging Het
Pcdh18 T C 3: 49,744,725 E1096G probably damaging Het
Pgm1 T A 5: 64,107,727 F364I probably benign Het
Pikfyve A G 1: 65,234,262 N612S probably damaging Het
Pla2g4e T G 2: 120,186,382 H226P possibly damaging Het
Ppp3cb T C 14: 20,520,646 N339S possibly damaging Het
Prkd2 G T 7: 16,843,648 probably benign Het
Rnf133 T C 6: 23,649,042 E296G possibly damaging Het
Sav1 A T 12: 69,984,321 D142E probably benign Het
Scn3b C A 9: 40,288,423 P212T probably damaging Het
Sel1l A T 12: 91,833,053 probably null Het
Sept9 A G 11: 117,360,484 K543E probably damaging Het
Serpinb12 T A 1: 106,949,153 D66E probably benign Het
Slc35e2 T C 4: 155,617,649 F290S probably benign Het
Snrpa A G 7: 27,195,533 M1T probably null Het
Soga1 T C 2: 157,039,924 K736R probably benign Het
Sptlc3 G A 2: 139,636,680 V520I probably benign Het
Srpk3 A G X: 73,774,941 H79R possibly damaging Het
Stox2 A G 8: 47,192,935 S497P probably damaging Het
Stradb G A 1: 58,993,572 S361N probably damaging Het
Sult3a2 T C 10: 33,782,087 K10R probably benign Het
Susd4 A G 1: 182,858,460 N192D probably damaging Het
Tcp10a T A 17: 7,325,975 D32E probably benign Het
Tdpoz4 T A 3: 93,797,032 V212D probably damaging Het
Tdrd5 T A 1: 156,284,374 T479S probably benign Het
Tex10 T C 4: 48,452,946 D671G probably benign Het
Traj37 T C 14: 54,181,539 probably benign Het
Ttc7b G A 12: 100,500,117 R79C probably damaging Het
Vmn2r115 T A 17: 23,346,399 L420Q probably benign Het
Wdr24 T A 17: 25,828,207 probably null Het
Wdr81 T A 11: 75,445,658 Q516L probably damaging Het
Zfp516 A G 18: 82,956,039 T121A probably benign Het
Zmat1 A T X: 134,972,945 S566T probably damaging Homo
Other mutations in Gif
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01604:Gif APN 19 11757762 missense probably benign 0.40
IGL02466:Gif APN 19 11752232 missense probably damaging 1.00
IGL02678:Gif APN 19 11748475 missense probably damaging 1.00
IGL02955:Gif APN 19 11747663 missense possibly damaging 0.93
R0048:Gif UTSW 19 11749756 missense possibly damaging 0.95
R0048:Gif UTSW 19 11749756 missense possibly damaging 0.95
R0135:Gif UTSW 19 11757754 missense probably damaging 1.00
R0606:Gif UTSW 19 11752294 missense possibly damaging 0.80
R1758:Gif UTSW 19 11757815 missense probably damaging 1.00
R1885:Gif UTSW 19 11752324 missense probably benign
R2054:Gif UTSW 19 11759006 missense probably benign 0.01
R3087:Gif UTSW 19 11760373 nonsense probably null
R4004:Gif UTSW 19 11759007 missense probably damaging 1.00
R4888:Gif UTSW 19 11752219 missense probably benign 0.16
R5546:Gif UTSW 19 11748495 missense possibly damaging 0.95
R5795:Gif UTSW 19 11760376 missense probably damaging 0.99
R6136:Gif UTSW 19 11750285 missense probably damaging 0.98
R6147:Gif UTSW 19 11747572 start gained probably benign
R7342:Gif UTSW 19 11763223 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGAGCTGTTAAGTTGTATACAAGTG -3'
(R):5'- TGCCTTACCTGCATGGCAAG -3'

Sequencing Primer
(F):5'- ACAAGTGTTTCTAAGTCTGCTGC -3'
(R):5'- CAAGGCCAGTGCTGTAGATGTC -3'
Posted On2017-12-01