Incidental Mutation 'R4604:Nbea'
ID 500691
Institutional Source Beutler Lab
Gene Symbol Nbea
Ensembl Gene ENSMUSG00000027799
Gene Name neurobeachin
Synonyms
MMRRC Submission 041816-MU
Accession Numbers

Genbank: NM_030595

Essential gene? Essential (E-score: 1.000) question?
Stock # R4604 (G1)
Quality Score 225
Status Not validated
Chromosome 3
Chromosomal Location 55625195-56183701 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 55723648 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 2186 (V2186A)
Ref Sequence ENSEMBL: ENSMUSP00000029374 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029374]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000029374
AA Change: V2186A

PolyPhen 2 Score 0.179 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000029374
Gene: ENSMUSG00000027799
AA Change: V2186A

DomainStartEndE-ValueType
low complexity region 19 40 N/A INTRINSIC
Pfam:Laminin_G_3 228 393 2.8e-13 PFAM
Pfam:DUF4704 462 733 4e-113 PFAM
low complexity region 792 802 N/A INTRINSIC
low complexity region 964 969 N/A INTRINSIC
low complexity region 1781 1790 N/A INTRINSIC
low complexity region 1791 1807 N/A INTRINSIC
low complexity region 1835 1845 N/A INTRINSIC
Pfam:DUF1088 1956 2122 3.5e-91 PFAM
Pfam:PH_BEACH 2148 2245 2.6e-32 PFAM
Beach 2276 2553 1.3e-205 SMART
WD40 2659 2696 2.12e2 SMART
WD40 2699 2742 2.22e0 SMART
WD40 2759 2798 9.21e0 SMART
WD40 2842 2880 2.88e-1 SMART
WD40 2883 2922 8.91e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198259
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199535
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a large, diverse group of A-kinase anchor proteins that target the activity of protein kinase A to specific subcellular sites by binding to its type II regulatory subunits. Brain-specific expression and coat protein-like membrane recruitment of a highly similar protein in mouse suggest an involvement in neuronal post-Golgi membrane traffic. Mutations in this gene may be associated with a form of autism. This gene and its expression are frequently disrupted in patients with multiple myeloma. Alternative splicing results in multiple transcript variants encoding distinct isoforms. Additional transcript variants may exist, but their full-length nature has not been determined.[provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for a gene trapped allele or transgene insertion die shortly after birth, are cyanotic, and exhibit no response to tactile stimuli, no spontaneous movement, and impaired CNS synaptic transmission. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Gene trapped(3) Transgenic(1)

Other mutations in this stock
Total: 106 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930518I15Rik C T 2: 156,857,154 (GRCm38) probably benign Het
Abcb6 G A 1: 75,179,877 (GRCm38) T81I probably benign Het
Acp6 A G 3: 97,175,759 (GRCm38) K362R probably benign Het
Adam26a A G 8: 43,570,051 (GRCm38) M134T probably benign Het
Ankrd27 C T 7: 35,628,490 (GRCm38) P812S probably damaging Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 (GRCm38) probably benign Het
Atp2a1 G A 7: 126,448,623 (GRCm38) R672C probably damaging Het
Atxn2 G T 5: 121,781,343 (GRCm38) W371C probably damaging Het
B3gnt2 T TTCACAAA 11: 22,836,426 (GRCm38) probably null Het
Btnl6 T A 17: 34,508,461 (GRCm38) D365V possibly damaging Het
Ccdc80 T A 16: 45,095,565 (GRCm38) L228Q probably damaging Het
Cdc42bpa A G 1: 180,109,194 (GRCm38) H718R probably benign Het
Cdh18 A G 15: 23,474,368 (GRCm38) K775E probably benign Het
Cdh23 T G 10: 60,337,666 (GRCm38) N1679T possibly damaging Het
Cep192 T A 18: 67,815,922 (GRCm38) D271E possibly damaging Het
Cfap70 G T 14: 20,443,661 (GRCm38) T124K probably benign Het
Ckap5 A T 2: 91,578,131 (GRCm38) E890D probably benign Het
Col22a1 G T 15: 71,952,339 (GRCm38) P569T probably benign Het
Colq A T 14: 31,545,103 (GRCm38) L150Q possibly damaging Het
Csf1 T C 3: 107,756,962 (GRCm38) probably null Het
Csmd3 A T 15: 48,004,815 (GRCm38) S770T possibly damaging Het
Cul9 C A 17: 46,530,146 (GRCm38) V733L probably damaging Het
Cyp2c55 A G 19: 39,031,386 (GRCm38) D256G possibly damaging Het
D17Wsu92e T C 17: 27,820,315 (GRCm38) D7G probably damaging Het
Dclk3 A T 9: 111,469,185 (GRCm38) D599V probably damaging Het
Defb26 T A 2: 152,508,184 (GRCm38) I59F possibly damaging Het
Dnah6 A G 6: 73,129,660 (GRCm38) V1646A possibly damaging Het
Dnm2 T C 9: 21,504,664 (GRCm38) probably null Het
Dock6 A G 9: 21,802,540 (GRCm38) L1867P probably damaging Het
Dock9 G T 14: 121,668,459 (GRCm38) T93K probably damaging Het
Dync2h1 T C 9: 7,140,995 (GRCm38) H1344R probably benign Het
Enam A C 5: 88,504,283 (GRCm38) Q1217P possibly damaging Het
Fbf1 A T 11: 116,158,922 (GRCm38) D91E possibly damaging Het
Fbxo7 T G 10: 86,046,802 (GRCm38) W393G probably damaging Het
Gab2 A G 7: 97,304,213 (GRCm38) T599A probably damaging Het
Gfy T A 7: 45,177,188 (GRCm38) I409F possibly damaging Het
Gm19345 T A 7: 19,857,508 (GRCm38) probably null Het
Gm4787 A G 12: 81,379,213 (GRCm38) M57T probably benign Het
Gper1 A G 5: 139,426,725 (GRCm38) E275G probably damaging Het
Grik4 T C 9: 42,524,586 (GRCm38) E803G probably damaging Het
Gstm3 G A 3: 107,968,197 (GRCm38) P39L possibly damaging Het
Hax1 A T 3: 89,997,460 (GRCm38) V142D probably damaging Het
Hcn3 A T 3: 89,150,440 (GRCm38) I383N probably damaging Het
Hdac10 C A 15: 89,125,397 (GRCm38) probably null Het
Hipk3 A C 2: 104,439,329 (GRCm38) M505R probably damaging Het
Hivep1 C T 13: 42,159,749 (GRCm38) P1822S probably benign Het
Hsd17b13 G T 5: 103,956,258 (GRCm38) H281N unknown Het
Irak2 T A 6: 113,672,887 (GRCm38) I222N probably damaging Het
Kalrn G A 16: 34,513,926 (GRCm38) L7F possibly damaging Het
Kcnma1 A G 14: 23,309,038 (GRCm38) probably null Het
Kcnn3 G T 3: 89,520,420 (GRCm38) probably benign Het
Lamb1 A C 12: 31,278,776 (GRCm38) D218A probably damaging Het
Lrrtm1 A T 6: 77,244,144 (GRCm38) N195Y probably damaging Het
Ltf A T 9: 111,022,341 (GRCm38) N72I probably damaging Het
Mcm4 A G 16: 15,629,663 (GRCm38) I479T probably damaging Het
Mfhas1 T C 8: 35,588,610 (GRCm38) S80P probably benign Het
Mknk1 A G 4: 115,878,027 (GRCm38) E364G probably damaging Het
Msh4 C T 3: 153,872,283 (GRCm38) C458Y probably damaging Het
Mtrr A T 13: 68,564,512 (GRCm38) probably null Het
Myo1a T C 10: 127,711,138 (GRCm38) W356R probably damaging Het
Nfe2l3 T C 6: 51,451,012 (GRCm38) S185P probably damaging Het
Nhsl1 A C 10: 18,531,410 (GRCm38) K1397Q probably damaging Het
Nmbr C T 10: 14,770,164 (GRCm38) R261W probably damaging Het
Npy2r A G 3: 82,541,058 (GRCm38) S137P probably damaging Het
Obscn C T 11: 59,080,205 (GRCm38) G2494D probably damaging Het
Obscn T C 11: 59,122,746 (GRCm38) K1092E probably damaging Het
Olfr1019 C T 2: 85,841,182 (GRCm38) C203Y probably damaging Het
Oosp2 A C 19: 11,649,683 (GRCm38) I92S probably benign Het
Pcdh9 T C 14: 93,887,180 (GRCm38) D518G probably damaging Het
Pde11a G T 2: 76,337,793 (GRCm38) T272K possibly damaging Het
Plekha2 T A 8: 25,059,835 (GRCm38) Q162L probably null Het
Prkag2 T A 5: 24,878,734 (GRCm38) I84F probably damaging Het
Prm2 G T 16: 10,791,749 (GRCm38) probably benign Het
Prpf40a A T 2: 53,142,023 (GRCm38) C800S probably damaging Het
Prr5l A T 2: 101,729,448 (GRCm38) C158S probably benign Het
Prrt3 C A 6: 113,498,237 (GRCm38) C8F possibly damaging Het
Psg25 T C 7: 18,529,803 (GRCm38) T32A probably benign Het
Ruvbl1 T C 6: 88,485,905 (GRCm38) V337A probably benign Het
Sall1 T A 8: 89,030,341 (GRCm38) Q1045L probably damaging Het
Sec22c T C 9: 121,695,642 (GRCm38) Y25C probably damaging Het
Serpina3i A T 12: 104,267,777 (GRCm38) T335S possibly damaging Het
Setd1b TCCACCACCACCACCACCACCACCA TCCACCACCACCACCACCACCA 5: 123,152,074 (GRCm38) probably benign Het
Slc12a8 T A 16: 33,608,159 (GRCm38) I279N probably damaging Het
Slc15a1 G A 14: 121,489,907 (GRCm38) T83I probably damaging Het
Slc22a3 A G 17: 12,459,771 (GRCm38) F222S probably benign Het
Sorcs3 A T 19: 48,693,914 (GRCm38) T463S probably benign Het
Spsb4 C A 9: 96,995,878 (GRCm38) A131S probably benign Het
Syne2 A G 12: 75,967,710 (GRCm38) E3225G probably damaging Het
Tchp G A 5: 114,719,573 (GRCm38) probably null Het
Tekt4 T A 17: 25,471,775 (GRCm38) D18E probably benign Het
Timm50 A G 7: 28,311,018 (GRCm38) V37A probably benign Het
Tlx2 A C 6: 83,068,760 (GRCm38) *285G probably null Het
Tmem173 T A 18: 35,738,690 (GRCm38) I170F probably damaging Het
Tshz1 C A 18: 84,013,374 (GRCm38) D970Y probably damaging Het
Ttn A T 2: 76,870,461 (GRCm38) V50E probably damaging Het
Txndc17 T A 11: 72,209,448 (GRCm38) S113T probably benign Het
Tyk2 T C 9: 21,108,009 (GRCm38) Y1039C probably damaging Het
Ubqln3 A G 7: 104,142,491 (GRCm38) S131P probably benign Het
Uncx A T 5: 139,544,082 (GRCm38) H30L possibly damaging Het
Usp25 T A 16: 77,115,415 (GRCm38) D1007E probably damaging Het
Usp47 T C 7: 112,101,831 (GRCm38) V1083A probably damaging Het
Wdr24 T A 17: 25,828,505 (GRCm38) H765Q probably damaging Het
Wrnip1 A G 13: 32,802,347 (GRCm38) D37G probably damaging Het
Xpo6 T C 7: 126,113,752 (GRCm38) T686A possibly damaging Het
Zfp941 G A 7: 140,812,211 (GRCm38) R412C probably damaging Het
Znrf2 T A 6: 54,878,440 (GRCm38) C71* probably null Het
Other mutations in Nbea
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00540:Nbea APN 3 55,628,493 (GRCm38) missense probably damaging 1.00
IGL00541:Nbea APN 3 55,968,089 (GRCm38) missense probably benign 0.02
IGL00584:Nbea APN 3 56,082,448 (GRCm38) missense probably damaging 0.98
IGL00648:Nbea APN 3 56,009,260 (GRCm38) missense probably damaging 0.98
IGL00785:Nbea APN 3 55,955,393 (GRCm38) missense probably benign
IGL00899:Nbea APN 3 55,642,845 (GRCm38) missense probably benign 0.32
IGL00955:Nbea APN 3 56,005,472 (GRCm38) missense possibly damaging 0.45
IGL01296:Nbea APN 3 56,031,536 (GRCm38) missense probably benign 0.04
IGL01299:Nbea APN 3 55,690,894 (GRCm38) missense probably damaging 1.00
IGL01393:Nbea APN 3 56,005,308 (GRCm38) missense probably benign 0.02
IGL01550:Nbea APN 3 55,805,248 (GRCm38) missense possibly damaging 0.93
IGL02023:Nbea APN 3 55,681,016 (GRCm38) missense probably damaging 1.00
IGL02034:Nbea APN 3 55,968,156 (GRCm38) missense probably damaging 1.00
IGL02061:Nbea APN 3 55,717,887 (GRCm38) missense possibly damaging 0.54
IGL02082:Nbea APN 3 55,968,167 (GRCm38) missense possibly damaging 0.88
IGL02113:Nbea APN 3 55,992,492 (GRCm38) missense probably benign
IGL02188:Nbea APN 3 55,983,837 (GRCm38) missense probably benign 0.00
IGL02319:Nbea APN 3 55,985,738 (GRCm38) missense probably damaging 1.00
IGL02406:Nbea APN 3 56,086,266 (GRCm38) missense probably benign 0.02
IGL02494:Nbea APN 3 55,805,351 (GRCm38) missense probably benign 0.02
IGL02550:Nbea APN 3 56,019,414 (GRCm38) missense probably damaging 0.98
IGL02706:Nbea APN 3 56,037,278 (GRCm38) missense probably damaging 1.00
IGL02718:Nbea APN 3 55,632,062 (GRCm38) nonsense probably null
IGL02822:Nbea APN 3 56,019,447 (GRCm38) missense possibly damaging 0.93
IGL02885:Nbea APN 3 55,631,986 (GRCm38) missense probably benign 0.01
IGL03000:Nbea APN 3 56,004,627 (GRCm38) missense possibly damaging 0.94
IGL03081:Nbea APN 3 56,079,918 (GRCm38) missense probably damaging 1.00
IGL03091:Nbea APN 3 56,085,304 (GRCm38) missense probably damaging 1.00
IGL03368:Nbea APN 3 56,079,930 (GRCm38) missense probably damaging 0.98
Neches UTSW 3 55,953,034 (GRCm38) critical splice donor site probably null
scotland UTSW 3 55,626,908 (GRCm38) missense probably damaging 1.00
Wales UTSW 3 56,091,119 (GRCm38) missense probably damaging 1.00
FR4340:Nbea UTSW 3 56,009,212 (GRCm38) critical splice donor site probably benign
G4846:Nbea UTSW 3 56,087,497 (GRCm38) missense probably damaging 0.98
IGL02835:Nbea UTSW 3 55,717,869 (GRCm38) missense possibly damaging 0.88
LCD18:Nbea UTSW 3 55,701,527 (GRCm38) intron probably benign
R0087:Nbea UTSW 3 56,091,023 (GRCm38) missense possibly damaging 0.92
R0220:Nbea UTSW 3 56,005,303 (GRCm38) missense probably benign 0.30
R0324:Nbea UTSW 3 56,057,948 (GRCm38) critical splice donor site probably null
R0330:Nbea UTSW 3 55,642,817 (GRCm38) missense probably benign 0.27
R0391:Nbea UTSW 3 56,037,277 (GRCm38) missense probably damaging 1.00
R0394:Nbea UTSW 3 56,029,907 (GRCm38) missense probably damaging 1.00
R0419:Nbea UTSW 3 55,819,294 (GRCm38) missense probably benign 0.05
R0503:Nbea UTSW 3 55,642,836 (GRCm38) missense possibly damaging 0.79
R0521:Nbea UTSW 3 56,008,268 (GRCm38) missense probably damaging 1.00
R0595:Nbea UTSW 3 55,628,496 (GRCm38) missense probably benign 0.18
R0894:Nbea UTSW 3 56,009,340 (GRCm38) missense possibly damaging 0.89
R1072:Nbea UTSW 3 56,086,196 (GRCm38) missense possibly damaging 0.94
R1125:Nbea UTSW 3 55,857,006 (GRCm38) nonsense probably null
R1169:Nbea UTSW 3 55,968,323 (GRCm38) missense probably benign 0.00
R1241:Nbea UTSW 3 56,058,040 (GRCm38) missense probably damaging 1.00
R1269:Nbea UTSW 3 56,004,781 (GRCm38) missense probably benign 0.05
R1406:Nbea UTSW 3 56,037,281 (GRCm38) missense probably benign 0.00
R1406:Nbea UTSW 3 56,037,281 (GRCm38) missense probably benign 0.00
R1457:Nbea UTSW 3 56,085,327 (GRCm38) missense probably damaging 1.00
R1482:Nbea UTSW 3 56,079,993 (GRCm38) missense probably damaging 1.00
R1483:Nbea UTSW 3 56,002,790 (GRCm38) missense probably benign 0.25
R1502:Nbea UTSW 3 56,004,889 (GRCm38) missense probably benign 0.03
R1544:Nbea UTSW 3 56,058,827 (GRCm38) missense probably damaging 0.99
R1629:Nbea UTSW 3 56,002,891 (GRCm38) missense possibly damaging 0.52
R1647:Nbea UTSW 3 55,630,229 (GRCm38) missense probably damaging 0.97
R1663:Nbea UTSW 3 55,645,986 (GRCm38) missense possibly damaging 0.95
R1722:Nbea UTSW 3 55,665,695 (GRCm38) missense probably damaging 1.00
R1757:Nbea UTSW 3 55,630,189 (GRCm38) missense possibly damaging 0.83
R1771:Nbea UTSW 3 55,934,519 (GRCm38) missense probably benign 0.00
R1796:Nbea UTSW 3 55,643,708 (GRCm38) missense possibly damaging 0.48
R1844:Nbea UTSW 3 56,082,436 (GRCm38) missense probably damaging 0.97
R1872:Nbea UTSW 3 55,642,889 (GRCm38) missense probably benign 0.12
R1938:Nbea UTSW 3 56,085,322 (GRCm38) missense probably damaging 1.00
R1940:Nbea UTSW 3 55,953,100 (GRCm38) missense possibly damaging 0.78
R2062:Nbea UTSW 3 56,086,157 (GRCm38) splice site probably benign
R2066:Nbea UTSW 3 55,968,146 (GRCm38) missense probably damaging 1.00
R2097:Nbea UTSW 3 55,723,217 (GRCm38) missense probably damaging 0.96
R2181:Nbea UTSW 3 56,029,939 (GRCm38) missense possibly damaging 0.92
R2274:Nbea UTSW 3 55,988,085 (GRCm38) splice site probably null
R2345:Nbea UTSW 3 56,085,279 (GRCm38) missense probably damaging 1.00
R2423:Nbea UTSW 3 56,085,306 (GRCm38) missense probably damaging 1.00
R2434:Nbea UTSW 3 55,647,460 (GRCm38) missense possibly damaging 0.91
R2880:Nbea UTSW 3 55,647,358 (GRCm38) missense probably benign 0.04
R2881:Nbea UTSW 3 55,647,358 (GRCm38) missense probably benign 0.04
R2940:Nbea UTSW 3 55,934,624 (GRCm38) missense probably benign 0.24
R3500:Nbea UTSW 3 55,681,010 (GRCm38) missense possibly damaging 0.88
R3765:Nbea UTSW 3 56,005,549 (GRCm38) missense probably damaging 1.00
R3790:Nbea UTSW 3 56,005,029 (GRCm38) missense probably benign
R3808:Nbea UTSW 3 55,717,848 (GRCm38) missense probably benign 0.02
R3845:Nbea UTSW 3 56,086,292 (GRCm38) splice site probably benign
R4182:Nbea UTSW 3 56,008,427 (GRCm38) missense probably damaging 0.99
R4385:Nbea UTSW 3 56,000,638 (GRCm38) missense possibly damaging 0.77
R4419:Nbea UTSW 3 56,009,600 (GRCm38) missense probably damaging 1.00
R4426:Nbea UTSW 3 56,082,379 (GRCm38) missense probably damaging 0.98
R4451:Nbea UTSW 3 55,992,332 (GRCm38) critical splice donor site probably null
R4456:Nbea UTSW 3 55,643,784 (GRCm38) missense probably benign 0.00
R4687:Nbea UTSW 3 56,058,065 (GRCm38) missense probably damaging 1.00
R4758:Nbea UTSW 3 56,005,403 (GRCm38) missense probably benign
R4840:Nbea UTSW 3 55,710,670 (GRCm38) missense probably benign 0.37
R4888:Nbea UTSW 3 56,005,355 (GRCm38) missense possibly damaging 0.61
R4954:Nbea UTSW 3 56,035,958 (GRCm38) missense probably damaging 1.00
R4972:Nbea UTSW 3 56,085,246 (GRCm38) missense probably damaging 0.99
R4980:Nbea UTSW 3 55,953,045 (GRCm38) missense probably benign 0.00
R4980:Nbea UTSW 3 55,647,351 (GRCm38) splice site probably null
R5104:Nbea UTSW 3 56,079,927 (GRCm38) missense probably damaging 1.00
R5139:Nbea UTSW 3 55,626,963 (GRCm38) missense possibly damaging 0.90
R5166:Nbea UTSW 3 56,019,453 (GRCm38) missense probably damaging 1.00
R5347:Nbea UTSW 3 56,040,876 (GRCm38) missense probably damaging 1.00
R5350:Nbea UTSW 3 56,019,424 (GRCm38) missense probably damaging 1.00
R5418:Nbea UTSW 3 55,645,989 (GRCm38) missense possibly damaging 0.86
R5586:Nbea UTSW 3 55,631,971 (GRCm38) missense probably benign 0.08
R5627:Nbea UTSW 3 55,992,345 (GRCm38) missense probably damaging 1.00
R5683:Nbea UTSW 3 55,628,586 (GRCm38) missense possibly damaging 0.53
R5765:Nbea UTSW 3 56,005,298 (GRCm38) missense probably benign 0.15
R5853:Nbea UTSW 3 55,992,401 (GRCm38) missense probably damaging 1.00
R5858:Nbea UTSW 3 55,953,034 (GRCm38) critical splice donor site probably null
R5955:Nbea UTSW 3 55,680,983 (GRCm38) missense probably benign 0.00
R5976:Nbea UTSW 3 55,853,847 (GRCm38) missense probably benign 0.30
R6039:Nbea UTSW 3 56,005,117 (GRCm38) missense probably benign 0.00
R6039:Nbea UTSW 3 56,005,117 (GRCm38) missense probably benign 0.00
R6043:Nbea UTSW 3 55,786,475 (GRCm38) missense probably benign 0.32
R6122:Nbea UTSW 3 56,029,896 (GRCm38) missense probably damaging 1.00
R6218:Nbea UTSW 3 55,628,484 (GRCm38) missense probably damaging 0.97
R6331:Nbea UTSW 3 56,000,616 (GRCm38) missense possibly damaging 0.94
R6334:Nbea UTSW 3 56,037,149 (GRCm38) missense probably damaging 1.00
R6393:Nbea UTSW 3 56,091,119 (GRCm38) missense probably damaging 1.00
R6411:Nbea UTSW 3 55,805,357 (GRCm38) missense probably benign 0.01
R6457:Nbea UTSW 3 56,000,569 (GRCm38) missense probably damaging 1.00
R6476:Nbea UTSW 3 56,004,806 (GRCm38) missense probably benign 0.00
R6488:Nbea UTSW 3 55,717,843 (GRCm38) missense probably damaging 0.99
R6700:Nbea UTSW 3 56,082,448 (GRCm38) missense possibly damaging 0.89
R6702:Nbea UTSW 3 56,005,502 (GRCm38) missense probably benign 0.06
R6752:Nbea UTSW 3 56,037,219 (GRCm38) missense probably benign
R6752:Nbea UTSW 3 55,968,309 (GRCm38) missense probably benign 0.02
R6804:Nbea UTSW 3 56,087,453 (GRCm38) missense probably benign 0.37
R6901:Nbea UTSW 3 56,019,415 (GRCm38) missense probably damaging 1.00
R6933:Nbea UTSW 3 55,723,610 (GRCm38) missense possibly damaging 0.63
R7124:Nbea UTSW 3 55,992,444 (GRCm38) missense probably damaging 1.00
R7211:Nbea UTSW 3 56,004,901 (GRCm38) missense probably benign 0.05
R7308:Nbea UTSW 3 56,091,031 (GRCm38) missense probably damaging 1.00
R7405:Nbea UTSW 3 55,805,266 (GRCm38) missense possibly damaging 0.94
R7669:Nbea UTSW 3 55,717,779 (GRCm38) missense probably damaging 1.00
R7762:Nbea UTSW 3 55,649,705 (GRCm38) missense probably damaging 1.00
R7833:Nbea UTSW 3 56,002,797 (GRCm38) missense probably damaging 1.00
R7885:Nbea UTSW 3 55,665,689 (GRCm38) missense probably damaging 0.97
R7935:Nbea UTSW 3 56,058,665 (GRCm38) missense probably damaging 1.00
R8050:Nbea UTSW 3 55,987,981 (GRCm38) missense probably damaging 0.99
R8108:Nbea UTSW 3 55,819,315 (GRCm38) missense probably benign 0.11
R8290:Nbea UTSW 3 56,058,635 (GRCm38) nonsense probably null
R8314:Nbea UTSW 3 56,009,251 (GRCm38) missense probably damaging 0.99
R8321:Nbea UTSW 3 56,183,097 (GRCm38) missense possibly damaging 0.86
R8376:Nbea UTSW 3 55,643,655 (GRCm38) missense possibly damaging 0.79
R8410:Nbea UTSW 3 56,037,263 (GRCm38) missense probably damaging 1.00
R8556:Nbea UTSW 3 55,647,386 (GRCm38) missense probably benign 0.25
R8753:Nbea UTSW 3 55,626,908 (GRCm38) missense probably damaging 1.00
R8844:Nbea UTSW 3 56,090,994 (GRCm38) missense probably damaging 0.97
R8884:Nbea UTSW 3 55,805,299 (GRCm38) missense probably benign 0.00
R8886:Nbea UTSW 3 56,058,727 (GRCm38) missense probably damaging 1.00
R8890:Nbea UTSW 3 56,019,363 (GRCm38) splice site probably benign
R9004:Nbea UTSW 3 56,002,938 (GRCm38) missense probably benign 0.01
R9022:Nbea UTSW 3 55,643,689 (GRCm38) missense possibly damaging 0.79
R9080:Nbea UTSW 3 56,005,095 (GRCm38) nonsense probably null
R9087:Nbea UTSW 3 55,642,736 (GRCm38) critical splice donor site probably null
R9104:Nbea UTSW 3 55,955,388 (GRCm38) missense probably benign
R9165:Nbea UTSW 3 56,004,868 (GRCm38) missense probably benign 0.15
R9219:Nbea UTSW 3 56,090,972 (GRCm38) frame shift probably null
R9221:Nbea UTSW 3 56,090,972 (GRCm38) frame shift probably null
R9222:Nbea UTSW 3 56,090,972 (GRCm38) frame shift probably null
R9260:Nbea UTSW 3 55,983,812 (GRCm38) missense possibly damaging 0.50
R9263:Nbea UTSW 3 56,090,972 (GRCm38) frame shift probably null
R9265:Nbea UTSW 3 56,090,972 (GRCm38) frame shift probably null
R9294:Nbea UTSW 3 56,091,092 (GRCm38) missense probably benign 0.00
R9360:Nbea UTSW 3 56,035,898 (GRCm38) missense possibly damaging 0.96
R9387:Nbea UTSW 3 55,991,039 (GRCm38) missense probably benign 0.12
R9428:Nbea UTSW 3 56,090,972 (GRCm38) frame shift probably null
R9435:Nbea UTSW 3 56,035,888 (GRCm38) missense possibly damaging 0.63
R9507:Nbea UTSW 3 55,665,590 (GRCm38) missense probably damaging 1.00
R9514:Nbea UTSW 3 56,029,945 (GRCm38) missense probably damaging 1.00
R9516:Nbea UTSW 3 56,029,945 (GRCm38) missense probably damaging 1.00
R9674:Nbea UTSW 3 56,058,762 (GRCm38) missense probably damaging 1.00
R9688:Nbea UTSW 3 55,649,744 (GRCm38) missense probably benign 0.42
R9709:Nbea UTSW 3 55,786,458 (GRCm38) nonsense probably null
RF051:Nbea UTSW 3 56,009,212 (GRCm38) critical splice donor site probably benign
X0018:Nbea UTSW 3 56,036,048 (GRCm38) missense probably benign 0.39
Z1088:Nbea UTSW 3 55,723,163 (GRCm38) missense probably benign 0.34
Z1177:Nbea UTSW 3 56,031,550 (GRCm38) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTGGTGACAGCACACAAAC -3'
(R):5'- CTTTCTGTTTAAGTCACAGGGTC -3'

Sequencing Primer
(F):5'- GGTGACAGCACACAAACAGGAATAC -3'
(R):5'- AGTCCTTTGTTTCCTCTTGAGTTAAG -3'
Posted On 2017-12-01