Incidental Mutation 'R4605:Extl1'
ID500695
Institutional Source Beutler Lab
Gene Symbol Extl1
Ensembl Gene ENSMUSG00000028838
Gene Nameexostoses (multiple)-like 1
SynonymsD430033M16Rik
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.513) question?
Stock #R4605 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location134356372-134383850 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 134359834 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 471 (V471A)
Ref Sequence ENSEMBL: ENSMUSP00000030643 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030643]
Predicted Effect probably benign
Transcript: ENSMUST00000030643
AA Change: V471A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000030643
Gene: ENSMUSG00000028838
AA Change: V471A

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:Exostosin 87 329 2.1e-38 PFAM
Pfam:Glyco_transf_64 412 652 1.7e-84 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132387
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142730
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the multiple exostoses (EXT) family of glycosyltransferases, which function in the chain polymerization of heparan sulfate and heparin. The encoded protein harbors alpha 1,4- N-acetylglucosaminyltransferase activity, and is involved in chain elongation of heparan sulfate and possibly heparin. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T C 1: 26,683,186 K971R probably benign Het
Ankra2 A G 13: 98,266,234 probably benign Het
Atp9b T A 18: 80,753,149 probably null Het
Birc6 G A 17: 74,639,934 D2885N probably damaging Het
Chaf1b A T 16: 93,888,089 N142I possibly damaging Het
Ckap5 G A 2: 91,576,214 G787S probably damaging Het
Ctc1 G T 11: 69,029,726 C372F possibly damaging Het
Dip2b A G 15: 100,209,636 T1176A probably benign Het
Epha10 A G 4: 124,885,757 E132G probably damaging Het
Fgd6 T C 10: 94,044,355 L357P probably benign Het
Gapvd1 A T 2: 34,728,537 C275S probably damaging Het
Kcnj2 G A 11: 111,072,850 C356Y probably damaging Het
Kcnk10 T C 12: 98,489,960 D204G probably damaging Het
Krtap9-1 A C 11: 99,873,753 E105A unknown Het
Loxhd1 G A 18: 77,405,946 V668I probably benign Het
Ly86 T C 13: 37,375,011 I62T possibly damaging Het
Maip1 A G 1: 57,411,732 I178V probably benign Het
Mical3 G A 6: 121,034,080 Q386* probably null Het
Olfr1057 G A 2: 86,374,797 T205I probably benign Het
Olfr1461 T A 19: 13,165,248 V78D probably damaging Het
Olfr235 T C 19: 12,269,168 *313Q probably null Het
Olfr472 A C 7: 107,903,238 I174L probably benign Het
Pcdha12 T C 18: 37,021,523 S432P probably damaging Het
Prex1 A T 2: 166,713,544 Y59N probably benign Het
Sbf1 A G 15: 89,303,481 F654L probably damaging Het
Sh2d5 T A 4: 138,257,255 Y187* probably null Het
Slc9a4 T C 1: 40,601,035 probably null Het
Smyd2 A G 1: 189,897,426 S136P probably damaging Het
Srsf11 A T 3: 158,022,923 L115* probably null Het
Tbx19 C T 1: 165,153,584 V114I possibly damaging Het
Unc5b A G 10: 60,774,403 V545A probably benign Het
Ush2a A G 1: 188,910,801 Y4120C probably damaging Het
Vps13a T C 19: 16,640,039 T3002A probably damaging Het
Zkscan2 A T 7: 123,498,724 W150R probably damaging Het
Other mutations in Extl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Extl1 APN 4 134358019 missense probably damaging 1.00
IGL01404:Extl1 APN 4 134359203 missense probably benign 0.06
IGL03040:Extl1 APN 4 134360629 splice site probably benign
R0165:Extl1 UTSW 4 134357703 missense probably damaging 1.00
R0566:Extl1 UTSW 4 134357677 unclassified probably benign
R0575:Extl1 UTSW 4 134357677 unclassified probably benign
R0941:Extl1 UTSW 4 134357677 unclassified probably benign
R0943:Extl1 UTSW 4 134357677 unclassified probably benign
R0988:Extl1 UTSW 4 134357677 unclassified probably benign
R0989:Extl1 UTSW 4 134357677 unclassified probably benign
R0990:Extl1 UTSW 4 134357677 unclassified probably benign
R1022:Extl1 UTSW 4 134357677 unclassified probably benign
R1035:Extl1 UTSW 4 134357677 unclassified probably benign
R1344:Extl1 UTSW 4 134359241 missense probably damaging 0.99
R1495:Extl1 UTSW 4 134357677 unclassified probably benign
R1699:Extl1 UTSW 4 134364583 nonsense probably null
R1750:Extl1 UTSW 4 134362688 missense probably benign 0.00
R1768:Extl1 UTSW 4 134371138 missense probably benign
R1883:Extl1 UTSW 4 134364606 missense probably benign 0.01
R2143:Extl1 UTSW 4 134371044 missense probably benign 0.31
R2144:Extl1 UTSW 4 134371044 missense probably benign 0.31
R2155:Extl1 UTSW 4 134363180 missense possibly damaging 0.71
R4298:Extl1 UTSW 4 134357658 missense probably damaging 1.00
R4606:Extl1 UTSW 4 134371379 missense probably damaging 0.99
R4606:Extl1 UTSW 4 134371380 missense probably benign 0.00
R4787:Extl1 UTSW 4 134364667 missense probably damaging 1.00
R5210:Extl1 UTSW 4 134360584 missense probably benign 0.02
R5776:Extl1 UTSW 4 134357772 missense possibly damaging 0.82
R6216:Extl1 UTSW 4 134363130 missense probably benign
R6392:Extl1 UTSW 4 134364634 missense probably benign 0.44
R6674:Extl1 UTSW 4 134358127 missense probably damaging 0.97
R7218:Extl1 UTSW 4 134359769 missense probably benign 0.14
X0020:Extl1 UTSW 4 134358021 unclassified probably null
Predicted Primers PCR Primer
(F):5'- GCCCAGCTATTACTTGACGTTTTAC -3'
(R):5'- TGGCCTTTAGAGCCAAAGGG -3'

Sequencing Primer
(F):5'- GACTTGGAGGGAACTTGCC -3'
(R):5'- GGAAACTATCACCTAGGCTTGTG -3'
Posted On2017-12-01