Incidental Mutation 'R4671:Myo1c'
ID500709
Institutional Source Beutler Lab
Gene Symbol Myo1c
Ensembl Gene ENSMUSG00000017774
Gene Namemyosin IC
SynonymsC80397, myosin-Ibeta, myr2, mm1beta
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.678) question?
Stock #R4671 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location75650504-75673910 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 75670030 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 770 (R770*)
Ref Sequence ENSEMBL: ENSMUSP00000104069 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069057] [ENSMUST00000102504] [ENSMUST00000102505] [ENSMUST00000108431]
Predicted Effect probably null
Transcript: ENSMUST00000069057
AA Change: R754*
SMART Domains Protein: ENSMUSP00000070388
Gene: ENSMUSG00000017774
AA Change: R754*

DomainStartEndE-ValueType
MYSc 5 697 N/A SMART
IQ 698 720 3.85e-3 SMART
IQ 721 743 2.09e-4 SMART
Blast:MYSc 751 780 5e-9 BLAST
low complexity region 804 815 N/A INTRINSIC
Pfam:Myosin_TH1 838 1024 1.9e-41 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000102504
AA Change: R754*
SMART Domains Protein: ENSMUSP00000099562
Gene: ENSMUSG00000017774
AA Change: R754*

DomainStartEndE-ValueType
MYSc 5 697 N/A SMART
IQ 698 720 3.85e-3 SMART
IQ 721 743 2.09e-4 SMART
Blast:MYSc 751 780 5e-9 BLAST
low complexity region 804 815 N/A INTRINSIC
Pfam:Myosin_TH1 838 1024 1.9e-41 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000102505
AA Change: R789*
SMART Domains Protein: ENSMUSP00000099563
Gene: ENSMUSG00000017774
AA Change: R789*

DomainStartEndE-ValueType
MYSc 40 732 N/A SMART
IQ 733 755 3.85e-3 SMART
IQ 756 778 2.09e-4 SMART
Blast:MYSc 786 815 6e-9 BLAST
low complexity region 839 850 N/A INTRINSIC
Pfam:Myosin_TH1 874 1052 2.9e-29 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000108431
AA Change: R770*
SMART Domains Protein: ENSMUSP00000104069
Gene: ENSMUSG00000017774
AA Change: R770*

DomainStartEndE-ValueType
MYSc 21 713 N/A SMART
IQ 714 736 3.85e-3 SMART
IQ 737 759 2.09e-4 SMART
Blast:MYSc 767 796 5e-9 BLAST
low complexity region 820 831 N/A INTRINSIC
Pfam:Myosin_TH1 854 1040 3.3e-41 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123064
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146419
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148659
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151174
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155027
Meta Mutation Damage Score 0.6264 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the unconventional myosin protein family, which are actin-based molecular motors. The protein is found in the cytoplasm, and one isoform with a unique N-terminus is also found in the nucleus. The protein functions in intracellular vesicle transport to the plasma membrane. The nuclear isoform associates with RNA polymerase I and II and functions in transcription initiation. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-in (Y61G) mutation that sensitizes to N6-modified ADP analogs display altered fast adaption in vestibular hair cells. Mice homozygous for a nuclear isoform-specifc knock-out allele exhibit minor changes in bone marrow density and red blood cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik A G 1: 105,718,859 I637V probably benign Het
Abcc2 T C 19: 43,800,718 S271P probably benign Het
Acod1 T G 14: 103,047,072 M2R probably benign Het
Adamts20 T C 15: 94,403,325 E106G possibly damaging Het
Adgra3 G A 5: 49,979,368 T661M probably damaging Het
Akap13 T A 7: 75,579,564 C161* probably null Het
Akr1c12 A C 13: 4,273,817 S162A possibly damaging Het
Anks1 C A 17: 28,051,578 H805N probably benign Het
Arhgap22 T C 14: 33,362,543 C260R probably damaging Het
Banf1 T C 19: 5,365,844 R33G probably benign Het
Bcas1 T C 2: 170,384,325 K310R probably damaging Het
Cacna1c G T 6: 118,652,058 H1240N probably damaging Het
Cartpt C T 13: 99,900,080 probably null Het
Ccdc127 T A 13: 74,357,045 Y237* probably null Het
Ccnb1ip1 A T 14: 50,792,277 Y109* probably null Het
Cenpj A T 14: 56,553,383 V403E possibly damaging Het
Cps1 A G 1: 67,196,560 Y951C probably damaging Het
Dcakd T C 11: 102,999,808 E51G possibly damaging Het
Dennd4a A T 9: 64,894,407 N944I probably benign Het
Dus3l C T 17: 56,768,566 R430C probably benign Het
Dync2h1 A G 9: 7,169,640 L279P possibly damaging Het
Dzip3 G A 16: 48,979,590 Q112* probably null Het
Eif1ad T A 19: 5,368,191 M1K probably null Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam46c C A 3: 100,473,199 L80F probably benign Het
Fancg T C 4: 43,005,272 E366G probably benign Het
Gin1 C T 1: 97,784,840 P154S probably damaging Het
Gm11938 A T 11: 99,603,006 C88S possibly damaging Het
Gm38394 A G 1: 133,657,040 V853A probably benign Het
Gpr183 T C 14: 121,954,737 D124G probably damaging Het
Gucy2g T A 19: 55,238,068 I139F probably damaging Het
Iqub A T 6: 24,479,184 M453K probably benign Het
Jcad A G 18: 4,674,175 T646A probably benign Het
Kif23 A T 9: 61,945,359 D24E probably benign Het
Kmt2c T C 5: 25,366,177 N845S probably damaging Het
Lhx5 G A 5: 120,439,967 S284N probably benign Het
Lipf T G 19: 33,976,676 V389G possibly damaging Het
Lrrc7 C T 3: 158,202,495 probably null Het
Magi1 A G 6: 93,680,787 probably null Het
Mast2 A G 4: 116,308,650 S1287P probably damaging Het
Mepce C T 5: 137,786,643 probably benign Het
Mkrn1 A G 6: 39,405,757 V173A probably damaging Het
Naip6 A G 13: 100,294,731 probably null Het
Nsmce3 A T 7: 64,872,782 L46Q probably benign Het
Olfr1294 A T 2: 111,537,935 M118K probably damaging Het
Olfr354 G A 2: 36,907,393 C149Y probably benign Het
Olfr531 T G 7: 140,400,305 Y247S probably damaging Het
Olfr681 T C 7: 105,122,306 L283P probably damaging Het
Olfr78 A G 7: 102,742,601 V134A probably damaging Het
Parp14 A G 16: 35,858,321 F426L probably benign Het
Pcf11 A T 7: 92,657,529 S1144T possibly damaging Het
Prpf3 T A 3: 95,851,664 T59S possibly damaging Het
Ptgir A G 7: 16,906,869 M29V possibly damaging Het
Ptk7 A G 17: 46,574,466 V678A probably benign Het
Rb1 A G 14: 73,273,676 L331S probably damaging Het
Sell A G 1: 164,065,473 Y86C probably damaging Het
Serpina1e G A 12: 103,948,082 R328W probably damaging Het
Sertad3 T G 7: 27,476,666 L175R possibly damaging Het
Stard9 G T 2: 120,698,640 G1793W probably damaging Het
Stra6 T C 9: 58,149,234 I383T probably benign Het
Tcf7l1 A G 6: 72,649,178 L154P probably damaging Het
Tonsl A T 15: 76,623,410 D55E probably benign Het
Ttc21b A G 2: 66,226,913 S572P possibly damaging Het
Ttc7 T A 17: 87,346,620 L575Q probably damaging Het
Ubl4b C T 3: 107,554,878 S22N probably damaging Het
Ubr4 T C 4: 139,436,191 V2634A possibly damaging Het
Zfp46 A C 4: 136,290,173 D106A probably damaging Het
Zfp951 A C 5: 104,814,701 I333S probably benign Het
Other mutations in Myo1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01346:Myo1c APN 11 75672250 missense probably damaging 1.00
IGL02054:Myo1c APN 11 75661136 missense probably benign 0.30
IGL02115:Myo1c APN 11 75661591 missense probably damaging 0.99
IGL02375:Myo1c APN 11 75661574 missense probably benign 0.00
IGL02878:Myo1c APN 11 75669033 missense possibly damaging 0.93
IGL03008:Myo1c APN 11 75658414 missense probably benign 0.13
Sweeper UTSW 11 75670030 nonsense probably null
R0070:Myo1c UTSW 11 75660250 missense probably benign 0.39
R0070:Myo1c UTSW 11 75660250 missense probably benign 0.39
R0138:Myo1c UTSW 11 75661001 missense possibly damaging 0.92
R0200:Myo1c UTSW 11 75672182 missense probably benign 0.00
R0227:Myo1c UTSW 11 75658694 missense probably benign 0.34
R0257:Myo1c UTSW 11 75665516 critical splice acceptor site probably null
R0513:Myo1c UTSW 11 75665831 splice site probably null
R0587:Myo1c UTSW 11 75657790 missense probably damaging 1.00
R0667:Myo1c UTSW 11 75668512 missense probably damaging 1.00
R1469:Myo1c UTSW 11 75669961 missense probably damaging 1.00
R1469:Myo1c UTSW 11 75669961 missense probably damaging 1.00
R1793:Myo1c UTSW 11 75657589 missense probably damaging 0.98
R1922:Myo1c UTSW 11 75668229 missense probably benign
R2000:Myo1c UTSW 11 75670579 missense probably damaging 1.00
R3983:Myo1c UTSW 11 75661499 missense probably benign 0.05
R4583:Myo1c UTSW 11 75671862 missense possibly damaging 0.72
R4599:Myo1c UTSW 11 75668193 missense probably damaging 0.99
R4682:Myo1c UTSW 11 75670030 nonsense probably null
R4708:Myo1c UTSW 11 75670030 nonsense probably null
R4709:Myo1c UTSW 11 75670030 nonsense probably null
R4742:Myo1c UTSW 11 75670030 nonsense probably null
R4770:Myo1c UTSW 11 75660313 nonsense probably null
R4888:Myo1c UTSW 11 75669227 missense probably damaging 1.00
R4915:Myo1c UTSW 11 75656309 start codon destroyed probably null
R4934:Myo1c UTSW 11 75671850 missense probably damaging 1.00
R4971:Myo1c UTSW 11 75671588 missense probably damaging 1.00
R5319:Myo1c UTSW 11 75662026 missense possibly damaging 0.95
R5589:Myo1c UTSW 11 75657588 missense possibly damaging 0.74
R5624:Myo1c UTSW 11 75662635 missense probably damaging 0.99
R5756:Myo1c UTSW 11 75658414 missense probably benign 0.42
R5959:Myo1c UTSW 11 75657519 missense probably benign 0.37
R6160:Myo1c UTSW 11 75650742 missense probably benign 0.00
R6559:Myo1c UTSW 11 75671635 missense probably benign 0.42
R6568:Myo1c UTSW 11 75671635 missense probably benign 0.42
R6569:Myo1c UTSW 11 75671635 missense probably benign 0.42
R6574:Myo1c UTSW 11 75656298 start gained probably benign
R6579:Myo1c UTSW 11 75671635 missense probably benign 0.42
R6580:Myo1c UTSW 11 75671635 missense probably benign 0.42
R6583:Myo1c UTSW 11 75671635 missense probably benign 0.42
R6640:Myo1c UTSW 11 75671635 missense probably benign 0.42
R6642:Myo1c UTSW 11 75671635 missense probably benign 0.42
R6643:Myo1c UTSW 11 75671635 missense probably benign 0.42
R6679:Myo1c UTSW 11 75671635 missense probably benign 0.42
R6680:Myo1c UTSW 11 75671635 missense probably benign 0.42
R6687:Myo1c UTSW 11 75672201 missense probably benign
R6695:Myo1c UTSW 11 75671635 missense probably benign 0.42
R6696:Myo1c UTSW 11 75671635 missense probably benign 0.42
R6700:Myo1c UTSW 11 75671635 missense probably benign 0.42
R6712:Myo1c UTSW 11 75671635 missense probably benign 0.42
R6713:Myo1c UTSW 11 75671635 missense probably benign 0.42
R6715:Myo1c UTSW 11 75671635 missense probably benign 0.42
R7081:Myo1c UTSW 11 75660963 missense probably benign
R7265:Myo1c UTSW 11 75669790 missense possibly damaging 0.89
R7397:Myo1c UTSW 11 75671242 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- ACCATGGCGAGAAGATAAAGGTC -3'
(R):5'- AGTCCCAGGCTAAGTGCTTTGAT -3'

Sequencing Primer
(F):5'- GTCAGCTATCTGTGGTATCC -3'
(R):5'- GATGACTATCCCTAACACAG -3'
Posted On2017-12-01