Incidental Mutation 'R4674:Pde1a'
ID500719
Institutional Source Beutler Lab
Gene Symbol Pde1a
Ensembl Gene ENSMUSG00000059173
Gene Namephosphodiesterase 1A, calmodulin-dependent
Synonyms
MMRRC Submission 041929-MU
Accession Numbers

Genbank: NM_001159582, NM_016744, NM_001009978, NM_001009979

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4674 (G1)
Quality Score217
Status Not validated
Chromosome2
Chromosomal Location79834453-80129458 bp(-) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) TCC to TC at 79898181 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000139327 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090756] [ENSMUST00000102651] [ENSMUST00000102652] [ENSMUST00000102653] [ENSMUST00000102654] [ENSMUST00000102655] [ENSMUST00000183775]
Predicted Effect probably benign
Transcript: ENSMUST00000090756
SMART Domains Protein: ENSMUSP00000088260
Gene: ENSMUSG00000059173

DomainStartEndE-ValueType
Pfam:PDEase_I_N 1 29 3.4e-11 PFAM
HDc 112 276 5.19e-7 SMART
low complexity region 344 357 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102651
SMART Domains Protein: ENSMUSP00000099711
Gene: ENSMUSG00000059173

DomainStartEndE-ValueType
Pfam:PDEase_I_N 5 65 9.3e-32 PFAM
HDc 148 312 5.19e-7 SMART
low complexity region 380 393 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102652
SMART Domains Protein: ENSMUSP00000099712
Gene: ENSMUSG00000059173

DomainStartEndE-ValueType
Pfam:PDEase_I_N 5 65 9e-32 PFAM
HDc 148 312 5.19e-7 SMART
low complexity region 380 393 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102653
SMART Domains Protein: ENSMUSP00000099713
Gene: ENSMUSG00000059173

DomainStartEndE-ValueType
Pfam:PDEase_I_N 73 133 1.2e-31 PFAM
HDc 216 380 5.19e-7 SMART
low complexity region 448 461 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102654
SMART Domains Protein: ENSMUSP00000099714
Gene: ENSMUSG00000059173

DomainStartEndE-ValueType
Pfam:PDEase_I_N 73 133 1.2e-31 PFAM
HDc 216 380 5.19e-7 SMART
low complexity region 448 461 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102655
SMART Domains Protein: ENSMUSP00000099715
Gene: ENSMUSG00000059173

DomainStartEndE-ValueType
Pfam:PDEase_I_N 73 133 7.8e-35 PFAM
HDc 216 380 5.19e-7 SMART
low complexity region 448 461 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000134739
SMART Domains Protein: ENSMUSP00000120188
Gene: ENSMUSG00000059173

DomainStartEndE-ValueType
Pfam:PDEase_I_N 41 101 1.4e-35 PFAM
HDc 184 348 5.19e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000183775
SMART Domains Protein: ENSMUSP00000139327
Gene: ENSMUSG00000059173

DomainStartEndE-ValueType
Pfam:PDEase_I_N 73 133 1.2e-31 PFAM
HDc 216 380 5.19e-7 SMART
low complexity region 448 461 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cyclic nucleotide phosphodiesterases (PDEs) play a role in signal transduction by regulating intracellular cyclic nucleotide concentrations through hydrolysis of cAMP and/or cGMP to their respective nucleoside 5-prime monophosphates. Members of the PDE1 family, such as PDE1A, are Ca(2+)/calmodulin (see CALM1; MIM 114180)-dependent PDEs (CaM-PDEs) that are activated by calmodulin in the presence of Ca(2+) (Michibata et al., 2001 [PubMed 11342109]; Fidock et al., 2002 [PubMed 11747989]).[supplied by OMIM, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b T C 5: 8,810,615 I112T probably benign Het
Acvr1b T C 15: 101,203,058 I367T possibly damaging Het
Akr1b8 G A 6: 34,356,424 probably null Het
Ash1l T C 3: 89,072,476 V2769A possibly damaging Het
Asxl3 A T 18: 22,517,738 D928V probably damaging Het
Atp1a4 A T 1: 172,257,656 V66E possibly damaging Het
Cald1 AAGAGAGAGAGAGAG AAGAGAGAGAGAG 6: 34,746,173 probably null Het
Cbx2 T A 11: 119,029,109 I500N probably damaging Het
Ccdc82 A T 9: 13,252,635 H184L probably benign Het
Cd84 A T 1: 171,873,320 H216L possibly damaging Het
Ceacam15 T C 7: 16,673,485 T36A probably benign Het
Cebpd A G 16: 15,887,521 D66G probably damaging Het
Clec1b C A 6: 129,400,134 L47I probably damaging Het
Cracr2b A G 7: 141,463,538 D43G probably damaging Het
Crbn T A 6: 106,790,971 Q173L possibly damaging Het
Cspg4 T C 9: 56,898,205 V2100A probably damaging Het
Cyp46a1 T C 12: 108,358,086 L374P probably damaging Het
Dhx16 T A 17: 35,885,939 V607E probably damaging Het
Dido1 A G 2: 180,687,559 S357P probably damaging Het
Dnah6 T A 6: 73,192,422 I399F probably benign Het
Dock10 T C 1: 80,606,620 E123G possibly damaging Het
Dstyk A G 1: 132,463,390 D843G probably benign Het
Efcab12 C A 6: 115,823,649 V138F probably damaging Het
Egf A G 3: 129,718,040 F493L probably damaging Het
Ephx1 A G 1: 180,994,691 F220S probably damaging Het
Exoc6 T C 19: 37,609,082 F644L probably damaging Het
F13b A G 1: 139,501,804 Y20C unknown Het
Fam184b T A 5: 45,582,888 K319* probably null Het
Fam208b T C 13: 3,573,686 E1406G possibly damaging Het
Flrt2 T A 12: 95,780,688 L600* probably null Het
Gbgt1 T C 2: 28,498,441 F46S possibly damaging Het
Gli2 T C 1: 118,836,029 E1464G probably damaging Het
Gm21731 T C 13: 120,240,826 W53R probably damaging Het
H2afy A C 13: 56,083,184 C297G possibly damaging Het
Hdac9 A G 12: 34,373,960 V501A possibly damaging Het
Heca T C 10: 17,915,309 H333R probably benign Het
Hirip3 G A 7: 126,864,662 probably null Het
Igsf8 G A 1: 172,318,912 W51* probably null Het
Kif21a C A 15: 90,940,545 R1342L possibly damaging Het
Krt73 T C 15: 101,802,075 N75D probably benign Het
Macf1 T A 4: 123,472,397 Y1292F probably benign Het
Mapk14 A G 17: 28,745,022 probably null Het
Mgat5 T A 1: 127,390,758 V330D probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Naip1 A T 13: 100,444,174 F188L probably damaging Het
Ncoa3 T C 2: 166,059,811 S1035P probably benign Het
Ndn T A 7: 62,348,822 W139R probably damaging Het
Nes T C 3: 87,971,795 V198A possibly damaging Het
Olfr1212 G T 2: 88,958,872 M135I probably damaging Het
Olfr1260 A G 2: 89,977,906 I43V possibly damaging Het
Olfr1465 T A 19: 13,313,814 H157L probably benign Het
Olfr497 T C 7: 108,423,102 V177A possibly damaging Het
Olfr613 T G 7: 103,551,976 L64V probably damaging Het
Olfr656 T A 7: 104,618,424 C248* probably null Het
Pcf11 G A 7: 92,659,777 probably benign Het
Pipox T G 11: 77,893,770 Q4P probably benign Het
Pla2g4c C T 7: 13,343,514 T327I probably null Het
Plppr1 C T 4: 49,323,384 R225W probably damaging Het
Pnpla6 T A 8: 3,521,412 V145D probably damaging Het
Pnpla7 T C 2: 25,052,317 Y83H probably damaging Het
Rif1 T A 2: 52,106,942 L970Q probably null Het
Rimklb C A 6: 122,456,283 E303* probably null Het
Rpl13a A T 7: 45,126,818 probably benign Het
Rttn T A 18: 89,011,011 probably null Het
Sf3b3 G A 8: 110,844,505 R10W probably damaging Het
Skint4 G A 4: 112,118,233 C130Y probably damaging Het
Snap91 A G 9: 86,792,017 S593P possibly damaging Het
Ssb A G 2: 69,868,850 Q209R probably benign Het
Stap1 A T 5: 86,081,185 I71L probably benign Het
Syna C A 5: 134,558,355 R580L probably damaging Het
Tacc2 T A 7: 130,624,861 M1111K possibly damaging Het
Tanc2 T C 11: 105,867,480 L689P probably damaging Het
Tdrd5 A C 1: 156,277,435 C463W probably damaging Het
Tet1 A G 10: 62,838,848 F1150L probably damaging Het
Tia1 T A 6: 86,420,400 F118L probably damaging Het
Trav3-1 A T 14: 52,581,003 T45S possibly damaging Het
Uaca A T 9: 60,854,429 Y235F possibly damaging Het
Ube4b T C 4: 149,331,370 N44S possibly damaging Het
Vmn2r93 T A 17: 18,304,993 H304Q probably benign Het
Wdr18 A G 10: 79,965,235 I161V probably benign Het
Zfp112 A G 7: 24,126,974 H789R probably damaging Het
Zfp873 A G 10: 82,059,980 T182A possibly damaging Het
Zscan2 T A 7: 80,875,402 S290R probably damaging Het
Zufsp A T 10: 33,948,984 D167E possibly damaging Het
Other mutations in Pde1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00423:Pde1a APN 2 79865670 missense probably damaging 1.00
IGL01860:Pde1a APN 2 79875284 missense probably damaging 1.00
IGL02059:Pde1a APN 2 79897077 missense possibly damaging 0.64
IGL02307:Pde1a APN 2 79906068 missense possibly damaging 0.70
IGL02376:Pde1a APN 2 79875223 splice site probably benign
IGL02569:Pde1a APN 2 79868258 missense probably benign 0.04
IGL03038:Pde1a APN 2 79887946 splice site probably benign
G5030:Pde1a UTSW 2 79887836 splice site probably benign
R0099:Pde1a UTSW 2 79868313 critical splice acceptor site probably null
R0549:Pde1a UTSW 2 79865070 missense probably damaging 1.00
R0960:Pde1a UTSW 2 79865034 splice site probably benign
R1855:Pde1a UTSW 2 79898064 critical splice donor site probably null
R1907:Pde1a UTSW 2 79868307 missense probably damaging 1.00
R1972:Pde1a UTSW 2 79865721 missense probably damaging 0.99
R2262:Pde1a UTSW 2 80128931 start gained probably benign
R4658:Pde1a UTSW 2 79898181 critical splice acceptor site probably benign
R4842:Pde1a UTSW 2 80128837 utr 5 prime probably benign
R4878:Pde1a UTSW 2 79878139 missense probably benign 0.05
R5161:Pde1a UTSW 2 79878144 missense probably null 1.00
R5473:Pde1a UTSW 2 79906028 missense probably damaging 1.00
R5940:Pde1a UTSW 2 79887839 critical splice donor site probably null
R5976:Pde1a UTSW 2 79868242 nonsense probably null
R6016:Pde1a UTSW 2 79865062 missense probably benign 0.01
R6242:Pde1a UTSW 2 80128792 missense probably benign
R6248:Pde1a UTSW 2 79878201 missense probably damaging 1.00
R6609:Pde1a UTSW 2 79906140 missense probably damaging 1.00
R6858:Pde1a UTSW 2 80129158 unclassified probably benign
R7161:Pde1a UTSW 2 79865214 missense probably benign 0.00
X0025:Pde1a UTSW 2 79838930 makesense probably null
Predicted Primers PCR Primer
(F):5'- GCTAAGTCAACCTGAAGGCATC -3'
(R):5'- GATGCCTGACAGCTAGACTCTC -3'

Sequencing Primer
(F):5'- ATCAATGGCTCAGTGCTCTG -3'
(R):5'- GCTAGACTCTCGAAGCTCAGTC -3'
Posted On2017-12-01