Incidental Mutation 'R4636:Ddx59'
ID500722
Institutional Source Beutler Lab
Gene Symbol Ddx59
Ensembl Gene ENSMUSG00000026404
Gene NameDEAD (Asp-Glu-Ala-Asp) box polypeptide 59
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4636 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location136415271-136440158 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 136432563 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 438 (N438K)
Ref Sequence ENSEMBL: ENSMUSP00000027655 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027655]
Predicted Effect probably damaging
Transcript: ENSMUST00000027655
AA Change: N438K

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000027655
Gene: ENSMUSG00000026404
AA Change: N438K

DomainStartEndE-ValueType
Pfam:zf-HIT 104 133 5.5e-11 PFAM
DEXDc 222 420 5.43e-55 SMART
HELICc 458 540 1.79e-23 SMART
low complexity region 583 596 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122959
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149783
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apcs T C 1: 172,894,422 E119G probably damaging Het
Arhgef5 A G 6: 43,274,942 T876A probably benign Het
Arih2 A T 9: 108,613,814 C227S probably damaging Het
Bsn A T 9: 108,115,424 L1043Q probably damaging Het
Cyp2d34 G C 15: 82,620,728 P44A probably damaging Het
Esr2 A G 12: 76,123,324 M447T possibly damaging Het
Fam131b A G 6: 42,320,980 S92P probably damaging Het
Galnt9 A G 5: 110,615,499 M457V probably damaging Het
Gorasp2 T A 2: 70,679,492 Y166N probably damaging Het
Gpat3 C T 5: 100,857,173 P58L probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Lmf1 G A 17: 25,654,471 V317M probably damaging Het
Lrp2 T C 2: 69,436,639 E4308G possibly damaging Het
Mrpl1 G T 5: 96,210,175 V5L probably benign Het
Nifk T A 1: 118,329,487 Y117N possibly damaging Het
Notch2 A G 3: 98,146,104 K2028E probably benign Het
Olfr1249 A C 2: 89,630,172 I242S possibly damaging Het
Prpf3 A G 3: 95,834,170 F558S probably damaging Het
Rabgap1l T C 1: 160,342,090 probably null Het
Rasa2 C T 9: 96,544,337 D819N probably benign Het
Rbl1 T A 2: 157,167,420 T732S possibly damaging Het
Slc14a2 A G 18: 78,195,792 V204A possibly damaging Het
Ttn A C 2: 76,813,593 L13097R probably damaging Het
Wdpcp A G 11: 21,711,568 E280G probably benign Het
Znhit6 A G 3: 145,600,578 silent Het
Znhit6 G T 3: 145,600,579 V280L probably null Het
Other mutations in Ddx59
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02148:Ddx59 APN 1 136433827 missense probably damaging 0.99
IGL02191:Ddx59 APN 1 136417158 missense probably damaging 1.00
IGL02525:Ddx59 APN 1 136417005 missense probably benign 0.03
IGL02712:Ddx59 APN 1 136439781 missense probably benign 0.14
R0219:Ddx59 UTSW 1 136432309 splice site probably benign
R0898:Ddx59 UTSW 1 136416941 missense probably damaging 1.00
R1728:Ddx59 UTSW 1 136417053 missense probably benign
R1729:Ddx59 UTSW 1 136417053 missense probably benign
R1730:Ddx59 UTSW 1 136417053 missense probably benign
R1739:Ddx59 UTSW 1 136417053 missense probably benign
R1762:Ddx59 UTSW 1 136417053 missense probably benign
R1783:Ddx59 UTSW 1 136417053 missense probably benign
R1784:Ddx59 UTSW 1 136417053 missense probably benign
R1785:Ddx59 UTSW 1 136417053 missense probably benign
R1817:Ddx59 UTSW 1 136432507 missense probably damaging 0.98
R1818:Ddx59 UTSW 1 136432507 missense probably damaging 0.98
R1819:Ddx59 UTSW 1 136432507 missense probably damaging 0.98
R2091:Ddx59 UTSW 1 136416709 missense probably benign
R3922:Ddx59 UTSW 1 136416744 missense probably benign
R3923:Ddx59 UTSW 1 136416744 missense probably benign
R3926:Ddx59 UTSW 1 136416744 missense probably benign
R3945:Ddx59 UTSW 1 136434618 missense probably damaging 0.99
R4182:Ddx59 UTSW 1 136439861 missense probably benign 0.01
R4589:Ddx59 UTSW 1 136439742 splice site probably null
R4721:Ddx59 UTSW 1 136417106 missense probably benign 0.00
R5276:Ddx59 UTSW 1 136419448 missense probably damaging 1.00
R6318:Ddx59 UTSW 1 136416872 missense probably damaging 0.99
R7602:Ddx59 UTSW 1 136433821 missense probably benign 0.01
Z1088:Ddx59 UTSW 1 136432451 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- GGTTTCTGCCACCATTCCAG -3'
(R):5'- TAGCACACCATGAGCTGAAGG -3'

Sequencing Primer
(F):5'- TTCTGCCACCATTCCAGATAGCATAG -3'
(R):5'- AGCTATATGGTTTCAGGCAAGCC -3'
Posted On2017-12-01