Incidental Mutation 'R4626:Fbln5'
ID500723
Institutional Source Beutler Lab
Gene Symbol Fbln5
Ensembl Gene ENSMUSG00000021186
Gene Namefibulin 5
SynonymsEVEC
MMRRC Submission 041891-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.243) question?
Stock #R4626 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location101746565-101819055 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 101760827 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 301 (D301V)
Ref Sequence ENSEMBL: ENSMUSP00000152680 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021603] [ENSMUST00000222587]
Predicted Effect probably damaging
Transcript: ENSMUST00000021603
AA Change: D288V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021603
Gene: ENSMUSG00000021186
AA Change: D288V

DomainStartEndE-ValueType
EGF_like 42 86 4.71e-1 SMART
EGF_CA 127 167 4.81e-8 SMART
EGF_CA 168 206 2.31e-10 SMART
EGF_CA 207 246 5.31e-10 SMART
EGF_CA 247 287 2.22e-12 SMART
EGF_like 288 333 8.14e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221373
Predicted Effect probably damaging
Transcript: ENSMUST00000222587
AA Change: D301V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a secreted, extracellular matrix protein containing an Arg-Gly-Asp (RGD) motif and calcium-binding EGF-like domains. It promotes adhesion of endothelial cells through interaction of integrins and the RGD motif. It is prominently expressed in developing arteries but less so in adult vessels. However, its expression is reinduced in balloon-injured vessels and atherosclerotic lesions, notably in intimal vascular smooth muscle cells and endothelial cells. Therefore, the protein encoded by this gene may play a role in vascular development and remodeling. Defects in this gene are a cause of autosomal dominant cutis laxa, autosomal recessive cutis laxa type I (CL type I), and age-related macular degeneration type 3 (ARMD3). [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this locus impairs elastic fiber development. Mutant mice exhibit loose skin, lung abnormalities leading to emphysema, and cardiovascular defects affecting the aorta. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatf A C 11: 84,422,958 *527G probably null Het
Abca17 A T 17: 24,321,084 I390N probably damaging Het
Adamts18 C T 8: 113,773,168 W371* probably null Het
Akr1c13 G T 13: 4,197,870 V214F probably damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Ankrd49 A C 9: 14,782,640 L77R probably damaging Het
Ap3b1 T A 13: 94,404,078 N169K possibly damaging Het
Arhgap39 A C 15: 76,737,637 F255V possibly damaging Het
Atp1a3 T A 7: 24,998,768 N171I possibly damaging Het
Atp9a T C 2: 168,639,943 D953G probably damaging Het
Atxn1 T C 13: 45,567,099 Y440C probably damaging Het
Bccip T C 7: 133,720,728 Y268H possibly damaging Het
Brms1l C A 12: 55,863,173 P243T probably benign Het
Btbd10 T C 7: 113,328,398 E250G probably damaging Het
Cacna1e T C 1: 154,482,548 probably null Het
Cfhr2 A T 1: 139,813,576 N220K probably damaging Het
Csnk1g2 C A 10: 80,639,814 A405E probably damaging Het
D5Ertd579e T C 5: 36,614,559 I831V possibly damaging Het
F2 T A 2: 91,630,670 N239I probably benign Het
Fbn2 A T 18: 58,013,747 C2692* probably null Het
Fhdc1 C T 3: 84,474,250 D34N probably damaging Het
Galnt13 T A 2: 54,857,866 M253K probably damaging Het
Gm11127 CTGGGTG CTG 17: 36,057,896 probably null Het
Gpc6 C A 14: 117,964,843 Y488* probably null Het
Grm5 G T 7: 88,130,153 G934C probably damaging Het
Gys1 T C 7: 45,439,534 L119S probably damaging Het
Htra4 T C 8: 25,037,114 N222D probably benign Het
Iba57 A G 11: 59,158,461 V294A probably benign Het
Kctd21 A G 7: 97,347,575 D85G probably damaging Het
Krt1 C T 15: 101,846,187 G543S unknown Het
Lama5 G A 2: 180,184,460 T2330M probably damaging Het
Lrguk G A 6: 34,129,223 E728K probably benign Het
Mcm6 T C 1: 128,351,548 D167G probably benign Het
Mettl18 T A 1: 163,996,476 V122E probably damaging Het
Mindy2 G A 9: 70,626,781 S378L probably damaging Het
Mis18bp1 G T 12: 65,140,766 F854L probably damaging Het
Mtdh C T 15: 34,114,834 R106* probably null Het
Nup214 T A 2: 32,033,404 V1315E possibly damaging Het
Nupl1 A G 14: 60,238,555 V271A probably benign Het
Olfr1188 T C 2: 88,559,832 V121A possibly damaging Het
Olfr3 A G 2: 36,812,259 Y278H probably damaging Het
Olfr523 T C 7: 140,176,446 S109P probably damaging Het
Orc5 G T 5: 22,548,005 F10L probably benign Het
Pcdha11 A T 18: 37,006,998 N560I probably damaging Het
Pcdhb9 T A 18: 37,402,249 F432Y probably benign Het
Peg10 GGATCC GGATCCCCATCAAGATCC 6: 4,756,460 probably benign Het
Poll C A 19: 45,555,124 M385I probably benign Het
Pomt1 A G 2: 32,254,412 K737E possibly damaging Het
Prr16 C T 18: 51,302,839 T130I probably damaging Het
Ptpn18 A G 1: 34,471,792 probably null Het
Ranbp6 A T 19: 29,810,863 Y696* probably null Het
Rmi1 A G 13: 58,409,136 R400G probably benign Het
Scn10a A G 9: 119,631,505 I1101T possibly damaging Het
Slc22a22 T C 15: 57,263,338 T93A probably damaging Het
Snx10 A G 6: 51,588,290 D129G probably damaging Het
Stub1 A G 17: 25,831,871 probably null Het
Tfr2 T C 5: 137,571,692 V120A probably benign Het
Trmu T C 15: 85,894,985 Y278H possibly damaging Het
Ugt2b36 A C 5: 87,092,088 F146C probably damaging Het
Vav2 T C 2: 27,270,160 I692V possibly damaging Het
Wdfy3 A G 5: 101,943,934 L513P probably damaging Het
Zfhx4 T A 3: 5,402,639 V2619D probably damaging Het
Zfyve26 T A 12: 79,269,070 N1211Y possibly damaging Het
Zp3r A G 1: 130,615,175 F142L probably damaging Het
Other mutations in Fbln5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00863:Fbln5 APN 12 101809916 missense probably damaging 0.98
IGL01357:Fbln5 APN 12 101750887 missense probably damaging 1.00
IGL01860:Fbln5 APN 12 101809869 missense probably damaging 1.00
IGL02567:Fbln5 APN 12 101761800 critical splice donor site probably null
BB004:Fbln5 UTSW 12 101818388 start gained probably benign
BB014:Fbln5 UTSW 12 101818388 start gained probably benign
R0368:Fbln5 UTSW 12 101809714 critical splice donor site probably null
R1080:Fbln5 UTSW 12 101750872 missense possibly damaging 0.90
R1606:Fbln5 UTSW 12 101765198 missense probably benign 0.04
R2107:Fbln5 UTSW 12 101771269 missense probably damaging 1.00
R2138:Fbln5 UTSW 12 101761920 missense probably benign 0.32
R3694:Fbln5 UTSW 12 101765252 missense probably benign 0.00
R3918:Fbln5 UTSW 12 101750791 missense probably damaging 1.00
R4166:Fbln5 UTSW 12 101757359 missense probably damaging 1.00
R5004:Fbln5 UTSW 12 101760821 missense probably damaging 0.99
R5264:Fbln5 UTSW 12 101757444 missense possibly damaging 0.94
R5364:Fbln5 UTSW 12 101771364 missense probably damaging 0.98
R5767:Fbln5 UTSW 12 101765209 missense probably damaging 0.97
R5889:Fbln5 UTSW 12 101765226 missense probably damaging 1.00
R5914:Fbln5 UTSW 12 101760743 missense possibly damaging 0.78
R6427:Fbln5 UTSW 12 101761822 missense possibly damaging 0.84
R7079:Fbln5 UTSW 12 101757408 missense probably damaging 1.00
R7343:Fbln5 UTSW 12 101760816 missense probably damaging 1.00
R7803:Fbln5 UTSW 12 101761818 missense probably damaging 1.00
R7927:Fbln5 UTSW 12 101818388 start gained probably benign
R8190:Fbln5 UTSW 12 101757296 missense probably damaging 0.99
R8381:Fbln5 UTSW 12 101761855 missense probably benign
Predicted Primers PCR Primer
(F):5'- TACTGACAGTCTCCTGAGCC -3'
(R):5'- ATGGTGGTGACAGACATCAG -3'

Sequencing Primer
(F):5'- TGAGCCAGGTCCCCATTC -3'
(R):5'- CACTCAAATTACTATGAACGTGGGC -3'
Posted On2017-12-01