Incidental Mutation 'R4632:Atp13a5'
Institutional Source Beutler Lab
Gene Symbol Atp13a5
Ensembl Gene ENSMUSG00000048939
Gene NameATPase type 13A5
MMRRC Submission 041897-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4632 (G1)
Quality Score225
Status Not validated
Chromosomal Location29231851-29378732 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 29348719 bp
Amino Acid Change Arginine to Tryptophan at position 138 (R138W)
Ref Sequence ENSEMBL: ENSMUSP00000114703 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075806] [ENSMUST00000142681] [ENSMUST00000143373] [ENSMUST00000152040]
Predicted Effect probably damaging
Transcript: ENSMUST00000075806
AA Change: R138W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000075204
Gene: ENSMUSG00000048939
AA Change: R138W

Pfam:P5-ATPase 17 142 4.1e-31 PFAM
Cation_ATPase_N 163 223 8.78e0 SMART
Pfam:E1-E2_ATPase 228 475 1.5e-35 PFAM
Pfam:Hydrolase 480 759 2.7e-11 PFAM
Pfam:HAD 483 857 1.1e-28 PFAM
Pfam:Cation_ATPase 564 638 1.3e-6 PFAM
transmembrane domain 901 923 N/A INTRINSIC
transmembrane domain 933 950 N/A INTRINSIC
transmembrane domain 971 993 N/A INTRINSIC
transmembrane domain 1042 1061 N/A INTRINSIC
transmembrane domain 1070 1092 N/A INTRINSIC
transmembrane domain 1107 1129 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000142681
AA Change: R138W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118627
Gene: ENSMUSG00000048939
AA Change: R138W

Pfam:P5-ATPase 17 142 7.5e-25 PFAM
Cation_ATPase_N 163 223 8.78e0 SMART
Pfam:E1-E2_ATPase 229 475 1e-36 PFAM
Pfam:Hydrolase 480 860 5.9e-16 PFAM
Pfam:HAD 483 857 4e-27 PFAM
Pfam:Hydrolase_like2 565 638 3.7e-8 PFAM
transmembrane domain 901 923 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000143373
AA Change: R138W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121208
Gene: ENSMUSG00000048939
AA Change: R138W

Pfam:P5-ATPase 17 142 1e-24 PFAM
Pfam:E1-E2_ATPase 196 430 3.2e-34 PFAM
Pfam:Hydrolase 435 815 9.1e-16 PFAM
Pfam:HAD 438 812 6.2e-27 PFAM
Pfam:Hydrolase_like2 520 593 4.8e-8 PFAM
transmembrane domain 856 878 N/A INTRINSIC
transmembrane domain 888 905 N/A INTRINSIC
transmembrane domain 926 948 N/A INTRINSIC
transmembrane domain 997 1016 N/A INTRINSIC
transmembrane domain 1025 1047 N/A INTRINSIC
transmembrane domain 1062 1084 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000152040
AA Change: R138W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114703
Gene: ENSMUSG00000048939
AA Change: R138W

Pfam:P5-ATPase 17 143 1.4e-25 PFAM
Cation_ATPase_N 149 209 8.78e0 SMART
low complexity region 213 227 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mutant mice show a decreased mean percentage of natural killer cells when compared with controls. Male homozygous mutant mice exhibit impaired sensorimotor gating/attention during prepulse inhibition testing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik T C 13: 63,068,092 S393P probably benign Het
Abcg1 T C 17: 31,064,473 V44A probably benign Het
Abr C T 11: 76,509,019 G39R probably benign Het
Adora2b TGGACCACTCCAGGACCACTC TGGACCACTC 11: 62,265,382 probably null Het
Agbl1 A G 7: 76,413,685 T47A probably benign Het
Akap13 G T 7: 75,666,553 A1389S possibly damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Ankar T A 1: 72,647,184 T1286S probably benign Het
Ankrd13c A G 3: 157,962,302 H166R probably damaging Het
Arl16 A G 11: 120,465,784 S130P probably damaging Het
Atp10a A T 7: 58,807,438 Q895L possibly damaging Het
Auts2 G A 5: 131,472,275 T309M probably damaging Het
C6 A T 15: 4,759,868 K265I probably benign Het
Casz1 A G 4: 148,951,855 T1525A possibly damaging Het
Chpf2 A G 5: 24,591,831 T592A probably benign Het
Cilp A T 9: 65,279,880 T1086S probably benign Het
Cmip A G 8: 117,447,411 Y410C possibly damaging Het
Csmd3 A G 15: 48,011,209 C560R probably damaging Het
Dchs1 T A 7: 105,754,355 E2993D probably benign Het
Dnah7a A G 1: 53,427,951 F3585L probably damaging Het
Dspp A G 5: 104,177,406 D545G unknown Het
Dusp7 T A 9: 106,370,766 S198T possibly damaging Het
Ell2 A T 13: 75,769,574 Q541L possibly damaging Het
Fzd1 A T 5: 4,755,865 Y572* probably null Het
Galntl6 T A 8: 58,427,823 I99F probably damaging Het
Gm609 T G 16: 45,417,908 H181P probably benign Het
Gnat3 G A 5: 18,015,366 probably null Het
Hykk T C 9: 54,946,516 I374T probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Kcnt2 A G 1: 140,523,148 I722V possibly damaging Het
Krt1 C T 15: 101,846,187 G543S unknown Het
Krt13 A G 11: 100,121,224 L91P possibly damaging Het
Krtap4-13 A C 11: 99,809,528 S102A unknown Het
Lrp2 A G 2: 69,489,129 probably null Het
Lrriq1 C T 10: 103,221,427 V171I probably damaging Het
Map3k4 C G 17: 12,232,504 E1501Q probably damaging Het
Mapk11 C T 15: 89,146,376 V105M probably damaging Het
Mlph G A 1: 90,939,386 A377T probably damaging Het
Myo9a G A 9: 59,869,664 C1115Y probably benign Het
Nabp1 A T 1: 51,474,602 Y78* probably null Het
Nos2 T C 11: 78,957,591 F1108S possibly damaging Het
Oas2 T C 5: 120,733,481 K699R probably benign Het
Olfm5 T C 7: 104,160,893 D87G probably benign Het
Olfr15 C T 16: 3,839,087 T38M probably damaging Het
Oog3 A G 4: 144,158,128 F413L probably benign Het
Pik3r4 A G 9: 105,654,899 M557V probably benign Het
Pkhd1l1 A G 15: 44,484,400 T224A probably benign Het
Pknox2 A G 9: 36,894,413 S367P probably benign Het
Ppfia2 A G 10: 106,836,044 probably null Het
Ppm1e G A 11: 87,231,530 P534S probably damaging Het
Prepl T C 17: 85,083,231 T100A probably benign Het
Ptpn13 A G 5: 103,569,860 N1924S possibly damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Samd12 T A 15: 53,719,671 H89L possibly damaging Het
Sephs1 T A 2: 4,896,760 V211E probably benign Het
Setx C T 2: 29,148,615 T1704I probably benign Het
Sltm T C 9: 70,579,369 S439P possibly damaging Het
Sort1 G T 3: 108,346,678 Q553H probably damaging Het
Svs2 G T 2: 164,237,747 T80N probably benign Het
Tanc1 C A 2: 59,795,835 T512K probably damaging Het
Tas2r139 T A 6: 42,141,498 V188E probably damaging Het
Tesk2 C T 4: 116,741,712 R6W probably benign Het
Tex101 G T 7: 24,668,368 C186* probably null Het
Timp2 C T 11: 118,303,772 S197N probably benign Het
Tmem37 A T 1: 120,068,249 C33S probably damaging Het
Tmem69 T C 4: 116,553,038 D245G probably benign Het
Trak1 G A 9: 121,454,425 R419Q probably benign Het
Ube2j2 T A 4: 155,955,258 I14N probably damaging Het
Ush2a T A 1: 188,395,874 N694K possibly damaging Het
Utp20 A G 10: 88,778,261 V1277A probably damaging Het
Vmn2r100 C T 17: 19,531,954 S753F probably damaging Het
Vmn2r103 T C 17: 19,793,696 I250T probably benign Het
Zap70 G T 1: 36,778,458 A261S probably benign Het
Zdhhc6 A G 19: 55,314,309 W87R probably damaging Het
Zfp410 A T 12: 84,325,736 D112V probably damaging Het
Zfp462 T C 4: 55,012,981 F501S probably damaging Het
Other mutations in Atp13a5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00331:Atp13a5 APN 16 29267014 nonsense probably null
IGL00583:Atp13a5 APN 16 29275453 splice site probably benign
IGL01472:Atp13a5 APN 16 29275423 missense probably damaging 1.00
IGL01473:Atp13a5 APN 16 29316724 missense probably damaging 1.00
IGL02142:Atp13a5 APN 16 29234563 missense probably benign 0.01
IGL02346:Atp13a5 APN 16 29327736 nonsense probably null
IGL02454:Atp13a5 APN 16 29232808 missense probably benign 0.35
IGL02557:Atp13a5 APN 16 29248182 missense probably benign 0.24
IGL02651:Atp13a5 APN 16 29334091 splice site probably benign
IGL02697:Atp13a5 APN 16 29348532 missense probably benign
IGL02704:Atp13a5 APN 16 29251328 nonsense probably null
IGL02993:Atp13a5 APN 16 29293504 nonsense probably null
IGL03329:Atp13a5 APN 16 29334065 nonsense probably null
IGL03346:Atp13a5 APN 16 29314604 missense probably benign 0.15
IGL03493:Atp13a5 APN 16 29297524 missense probably benign
PIT4810001:Atp13a5 UTSW 16 29314564 missense probably damaging 1.00
R0356:Atp13a5 UTSW 16 29348755 splice site probably benign
R0393:Atp13a5 UTSW 16 29266929 splice site probably benign
R0456:Atp13a5 UTSW 16 29232740 missense probably benign 0.03
R0526:Atp13a5 UTSW 16 29348740 missense probably damaging 0.97
R0632:Atp13a5 UTSW 16 29298208 missense probably benign 0.00
R0674:Atp13a5 UTSW 16 29248350 splice site probably benign
R1417:Atp13a5 UTSW 16 29298235 missense probably benign 0.00
R1470:Atp13a5 UTSW 16 29349015 missense probably benign 0.19
R1470:Atp13a5 UTSW 16 29349015 missense probably benign 0.19
R1515:Atp13a5 UTSW 16 29333974 missense probably benign 0.23
R1659:Atp13a5 UTSW 16 29293433 missense probably benign
R1723:Atp13a5 UTSW 16 29232799 missense possibly damaging 0.88
R1779:Atp13a5 UTSW 16 29314660 missense possibly damaging 0.67
R1794:Atp13a5 UTSW 16 29321709 missense probably damaging 1.00
R1958:Atp13a5 UTSW 16 29314601 missense probably damaging 1.00
R2218:Atp13a5 UTSW 16 29321646 missense probably damaging 0.99
R2282:Atp13a5 UTSW 16 29237321 missense probably damaging 1.00
R2356:Atp13a5 UTSW 16 29281069 missense probably damaging 1.00
R2365:Atp13a5 UTSW 16 29251256 missense probably benign 0.00
R2497:Atp13a5 UTSW 16 29339071 nonsense probably null
R2517:Atp13a5 UTSW 16 29297397 missense possibly damaging 0.79
R3552:Atp13a5 UTSW 16 29310766 missense probably damaging 1.00
R3685:Atp13a5 UTSW 16 29316755 missense probably damaging 1.00
R3957:Atp13a5 UTSW 16 29298194 missense probably benign 0.01
R4433:Atp13a5 UTSW 16 29282024 missense probably damaging 0.99
R4503:Atp13a5 UTSW 16 29293528 missense probably benign 0.37
R4579:Atp13a5 UTSW 16 29248338 critical splice acceptor site probably null
R4718:Atp13a5 UTSW 16 29248170 missense probably damaging 1.00
R4865:Atp13a5 UTSW 16 29248160 missense probably damaging 0.98
R4899:Atp13a5 UTSW 16 29378500 missense probably damaging 1.00
R4909:Atp13a5 UTSW 16 29334028 missense possibly damaging 0.81
R5011:Atp13a5 UTSW 16 29350748 missense probably damaging 1.00
R5013:Atp13a5 UTSW 16 29350748 missense probably damaging 1.00
R5032:Atp13a5 UTSW 16 29263450 missense probably damaging 1.00
R5226:Atp13a5 UTSW 16 29248279 missense probably damaging 1.00
R5485:Atp13a5 UTSW 16 29281942 critical splice donor site probably null
R5598:Atp13a5 UTSW 16 29257077 intron probably benign
R5945:Atp13a5 UTSW 16 29237243 missense probably benign 0.06
R5958:Atp13a5 UTSW 16 29339042 missense probably damaging 1.00
R6194:Atp13a5 UTSW 16 29308239 missense probably damaging 1.00
R6214:Atp13a5 UTSW 16 29251407 missense probably damaging 1.00
R6273:Atp13a5 UTSW 16 29348737 missense probably benign 0.10
R6376:Atp13a5 UTSW 16 29237252 missense probably benign 0.00
R6431:Atp13a5 UTSW 16 29251402 missense possibly damaging 0.93
R6495:Atp13a5 UTSW 16 29321622 critical splice donor site probably null
R6619:Atp13a5 UTSW 16 29349015 missense probably benign 0.05
R6853:Atp13a5 UTSW 16 29321662 missense possibly damaging 0.94
R6932:Atp13a5 UTSW 16 29281951 missense probably damaging 1.00
R7070:Atp13a5 UTSW 16 29334061 missense possibly damaging 0.88
R7343:Atp13a5 UTSW 16 29321749 missense probably benign 0.01
R7425:Atp13a5 UTSW 16 29297460 nonsense probably null
R7570:Atp13a5 UTSW 16 29266963 missense probably damaging 1.00
R7781:Atp13a5 UTSW 16 29297408 missense probably benign 0.00
X0023:Atp13a5 UTSW 16 29310782 missense probably damaging 1.00
Z1088:Atp13a5 UTSW 16 29282062 missense probably benign 0.06
Predicted Primers PCR Primer

Sequencing Primer
Posted On2017-12-01