Incidental Mutation 'R4643:Lgi1'
ID500748
Institutional Source Beutler Lab
Gene Symbol Lgi1
Ensembl Gene ENSMUSG00000067242
Gene Nameleucine-rich repeat LGI family, member 1
Synonyms
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.770) question?
Stock #R4643 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location38264536-38312214 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 38300710 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 145 (D145V)
Ref Sequence ENSEMBL: ENSMUSP00000143502 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087252] [ENSMUST00000196090] [ENSMUST00000197123] [ENSMUST00000198045] [ENSMUST00000198518] [ENSMUST00000199812]
Predicted Effect probably benign
Transcript: ENSMUST00000087252
SMART Domains Protein: ENSMUSP00000084507
Gene: ENSMUSG00000067242

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
LRRNT 41 71 9.09e0 SMART
LRR 90 113 2.61e2 SMART
LRR_TYP 114 137 5.14e-3 SMART
LRR_TYP 138 161 2.27e-4 SMART
LRRCT 173 222 4.63e-6 SMART
Pfam:EPTP 225 266 3.8e-9 PFAM
Pfam:EPTP 271 312 6.5e-12 PFAM
Pfam:EPTP 317 363 7.2e-16 PFAM
Pfam:EPTP 366 414 1.4e-7 PFAM
Pfam:EPTP 419 461 1.6e-12 PFAM
Pfam:EPTP 464 505 7.7e-11 PFAM
Pfam:EPTP 510 550 3.4e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130039
SMART Domains Protein: ENSMUSP00000117936
Gene: ENSMUSG00000067242

DomainStartEndE-ValueType
low complexity region 11 38 N/A INTRINSIC
LRR 51 74 2.61e2 SMART
LRR_TYP 75 98 5.14e-3 SMART
LRR_TYP 99 122 2.27e-4 SMART
LRRCT 131 180 4.63e-6 SMART
Pfam:EPTP 182 218 3e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000196090
AA Change: D121V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143538
Gene: ENSMUSG00000067242
AA Change: D121V

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
LRRNT 41 71 4.4e-2 SMART
LRR_TYP 90 113 3.3e-4 SMART
LRRCT 125 174 2.3e-8 SMART
Pfam:EPTP 177 218 3.1e-6 PFAM
Pfam:EPTP 223 264 5.3e-9 PFAM
Pfam:EPTP 269 315 5.8e-13 PFAM
Pfam:EPTP 318 366 1.1e-4 PFAM
Pfam:EPTP 371 413 1.3e-9 PFAM
Pfam:EPTP 416 457 6.2e-8 PFAM
Pfam:EPTP 462 502 2.7e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000197123
SMART Domains Protein: ENSMUSP00000142953
Gene: ENSMUSG00000067242

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
LRRNT 41 71 4.3e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000198045
AA Change: D169V

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000143292
Gene: ENSMUSG00000067242
AA Change: D169V

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
LRRNT 41 71 4.3e-2 SMART
LRR 90 113 1.1e0 SMART
LRR_TYP 114 137 2.1e-5 SMART
LRR_TYP 138 161 9.2e-7 SMART
LRRCT 173 222 2.3e-8 SMART
Pfam:EPTP 224 267 2.8e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000198518
AA Change: D169V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143128
Gene: ENSMUSG00000067242
AA Change: D169V

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
LRRNT 41 71 9.09e0 SMART
LRR 90 113 2.61e2 SMART
LRR_TYP 114 137 5.14e-3 SMART
LRR_TYP 138 161 2.27e-4 SMART
LRRCT 173 222 4.63e-6 SMART
Pfam:EPTP 224 267 8.3e-15 PFAM
Pfam:EPTP 270 313 9.4e-16 PFAM
Pfam:EPTP 316 364 3.3e-18 PFAM
Pfam:EPTP 365 415 5.2e-8 PFAM
Pfam:EPTP 418 462 1e-16 PFAM
Pfam:EPTP 463 506 1.9e-15 PFAM
Pfam:EPTP 509 550 2.8e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000199812
AA Change: D145V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143502
Gene: ENSMUSG00000067242
AA Change: D145V

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
LRRNT 41 71 4.4e-2 SMART
LRR_TYP 90 113 2.2e-5 SMART
LRR_TYP 114 137 9.4e-7 SMART
LRRCT 149 198 2.3e-8 SMART
Pfam:EPTP 201 242 3.2e-6 PFAM
Pfam:EPTP 247 288 5.6e-9 PFAM
Pfam:EPTP 293 339 6.1e-13 PFAM
Pfam:EPTP 342 390 1.2e-4 PFAM
Pfam:EPTP 395 437 1.4e-9 PFAM
Pfam:EPTP 440 481 6.6e-8 PFAM
Pfam:EPTP 486 526 2.9e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200561
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the secreted leucine-rich repeat (LRR) superfamily and shares homology with members of the SLIT protein family. The encoded protein may regulate the activity of voltage-gated potassium channels and may be involved in neuronal growth regulation and cell survival. This gene is rearranged as a result of translocations in glioblastoma cell lines, and it is frequently down-regulated or rearranged in malignant gliomas. Mutations in this gene result in autosomal dominant lateral temporal epilepsy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit growth retardation, seizures, and death by the third week of life. Mice heterozygous for this allele exhibit increased suseptibility to pentylenetetrazole-induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik A G 13: 119,474,860 N398D probably damaging Het
Adamtsl4 G A 3: 95,684,619 A58V possibly damaging Het
Anapc2 T A 2: 25,276,394 V105E probably benign Het
C3ar1 A T 6: 122,850,974 C95S probably damaging Het
Ccdc87 G A 19: 4,841,849 G790R probably damaging Het
Cenpf A T 1: 189,659,589 M682K probably benign Het
Cyp2j13 T C 4: 96,056,924 Q289R possibly damaging Het
Dclk2 A T 3: 86,806,180 M453K possibly damaging Het
Dscam G A 16: 96,685,301 T1058M probably damaging Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Grip1 A G 10: 120,020,101 N659S probably damaging Het
Hectd4 A G 5: 121,349,055 K3371R possibly damaging Het
Il1a T A 2: 129,304,703 T157S probably benign Het
Il23r A G 6: 67,423,993 V451A probably benign Het
Iqch T C 9: 63,594,802 T40A probably benign Het
Kazald1 G T 19: 45,078,349 V196L probably benign Het
L1td1 T C 4: 98,737,883 S772P probably damaging Het
Lrmp A T 6: 145,168,060 D318V probably benign Het
Lrp12 A T 15: 39,872,022 L838Q probably damaging Het
Mrgprf C A 7: 145,308,505 P268Q probably benign Het
Myef2 T C 2: 125,116,811 K66R possibly damaging Het
Myo3b A G 2: 70,238,842 D475G possibly damaging Het
Numa1 C G 7: 102,000,665 probably null Het
Olfr807 T C 10: 129,754,955 E165G probably damaging Het
Prdm8 T C 5: 98,184,587 S116P possibly damaging Het
Pyroxd1 C G 6: 142,354,741 S199* probably null Het
R3hcc1l G T 19: 42,562,800 V79F probably benign Het
Rasal1 C T 5: 120,678,964 T779I probably benign Het
Scaper A C 9: 55,838,179 F596V probably damaging Het
Slco2b1 C T 7: 99,667,007 V439M probably benign Het
Slco6c1 A T 1: 97,062,424 D680E probably benign Het
Smurf1 A T 5: 144,879,369 F725L probably damaging Het
Snd1 A G 6: 28,880,249 E674G probably benign Het
Srcap C T 7: 127,541,776 P1515L probably damaging Het
Sycp2l A G 13: 41,143,465 M341V probably benign Het
Tmprss6 T A 15: 78,445,356 I492F probably damaging Het
Trip10 G T 17: 57,261,658 E416* probably null Het
Tstd2 T C 4: 46,129,297 D177G possibly damaging Het
Ugt1a5 A T 1: 88,166,425 N125I possibly damaging Het
Vmn2r7 G T 3: 64,716,404 S165Y probably damaging Het
Zfp663 A T 2: 165,353,005 H431Q probably benign Het
Other mutations in Lgi1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02882:Lgi1 APN 19 38284005 missense probably benign 0.24
IGL03112:Lgi1 APN 19 38284030 missense possibly damaging 0.84
R0201:Lgi1 UTSW 19 38301293 missense possibly damaging 0.92
R1573:Lgi1 UTSW 19 38284181 missense probably benign 0.30
R1795:Lgi1 UTSW 19 38306183 missense probably benign
R2010:Lgi1 UTSW 19 38301235 missense probably damaging 1.00
R3732:Lgi1 UTSW 19 38306246 missense probably damaging 1.00
R3732:Lgi1 UTSW 19 38306246 missense probably damaging 1.00
R3733:Lgi1 UTSW 19 38306246 missense probably damaging 1.00
R4678:Lgi1 UTSW 19 38301289 missense probably damaging 1.00
R4814:Lgi1 UTSW 19 38300878 critical splice donor site probably null
R4857:Lgi1 UTSW 19 38306250 missense probably damaging 1.00
R5598:Lgi1 UTSW 19 38306181 missense possibly damaging 0.94
R6180:Lgi1 UTSW 19 38264956 missense probably damaging 1.00
R6196:Lgi1 UTSW 19 38305809 missense probably benign 0.23
R6847:Lgi1 UTSW 19 38301290 missense probably damaging 1.00
R7178:Lgi1 UTSW 19 38306285 missense probably damaging 1.00
R7376:Lgi1 UTSW 19 38284020 missense probably damaging 1.00
R7448:Lgi1 UTSW 19 38301265 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATAGGTTACTAGGATCTGGGTGGC -3'
(R):5'- CACACATTAAATCGCTCAGATGG -3'

Sequencing Primer
(F):5'- CTTTAGGGGTGCTCTGTGATCACC -3'
(R):5'- AAATCGCTCAGATGGTTCTTAAC -3'
Posted On2017-12-01