Incidental Mutation 'R4666:Lrrc7'
ID500750
Institutional Source Beutler Lab
Gene Symbol Lrrc7
Ensembl Gene ENSMUSG00000028176
Gene Nameleucine rich repeat containing 7
Synonymsdensin
MMRRC Submission 041924-MU
Accession Numbers

Genbank: NM_001081358; MGI: 2676665

Is this an essential gene? Possibly essential (E-score: 0.567) question?
Stock #R4666 (G1)
Quality Score184
Status Not validated
Chromosome3
Chromosomal Location158082891-158562221 bp(-) (GRCm38)
Type of Mutationcritical splice donor site
DNA Base Change (assembly) GAAGTTGTTTGGAGATTCTTATCTTA to GA at 158318408 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000106044] [ENSMUST00000199890] [ENSMUST00000200137]
Predicted Effect probably benign
Transcript: ENSMUST00000106044
SMART Domains Protein: ENSMUSP00000101659
Gene: ENSMUSG00000028176

DomainStartEndE-ValueType
LRR 53 73 3.65e0 SMART
LRR 96 118 2.2e1 SMART
LRR 142 164 4.21e1 SMART
LRR 165 187 7.36e0 SMART
LRR 188 210 7.05e-1 SMART
LRR 211 233 3.09e1 SMART
LRR 234 257 4.21e1 SMART
LRR 258 279 2.61e2 SMART
LRR 280 303 3.52e-1 SMART
LRR 326 349 1.99e0 SMART
LRR 372 394 2.63e0 SMART
low complexity region 466 476 N/A INTRINSIC
low complexity region 692 705 N/A INTRINSIC
Blast:PDZ 708 736 1e-5 BLAST
low complexity region 787 797 N/A INTRINSIC
low complexity region 864 878 N/A INTRINSIC
Blast:PDZ 1349 1378 2e-11 BLAST
PDZ 1460 1540 1.33e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000199890
SMART Domains Protein: ENSMUSP00000142440
Gene: ENSMUSG00000028176

DomainStartEndE-ValueType
LRR 53 73 3.65e0 SMART
LRR 96 118 2.2e1 SMART
LRR 142 164 4.21e1 SMART
LRR 165 187 7.36e0 SMART
LRR 188 210 7.05e-1 SMART
LRR 211 233 3.09e1 SMART
LRR 234 257 4.21e1 SMART
LRR 258 279 2.61e2 SMART
LRR 280 303 3.52e-1 SMART
LRR 326 349 1.99e0 SMART
LRR 372 394 2.63e0 SMART
low complexity region 466 476 N/A INTRINSIC
low complexity region 692 705 N/A INTRINSIC
Blast:PDZ 708 736 9e-6 BLAST
low complexity region 787 797 N/A INTRINSIC
low complexity region 864 878 N/A INTRINSIC
Blast:PDZ 1328 1364 1e-15 BLAST
low complexity region 1374 1387 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200137
SMART Domains Protein: ENSMUSP00000142498
Gene: ENSMUSG00000028176

DomainStartEndE-ValueType
LRR 52 69 7.6e-1 SMART
LRR 73 92 4.2e-1 SMART
LRR 96 115 3.4e-1 SMART
LRR 142 164 1.8e-1 SMART
LRR 165 184 1.5e-1 SMART
LRR 188 207 2e-2 SMART
LRR 211 233 1.3e-1 SMART
LRR 234 257 1.7e-1 SMART
LRR 257 276 1e0 SMART
LRR 280 299 3.1e-2 SMART
LRR 303 322 6.6e-1 SMART
LRR 326 345 2.1e-1 SMART
LRR 372 391 1.2e-1 SMART
low complexity region 466 476 N/A INTRINSIC
low complexity region 692 705 N/A INTRINSIC
Blast:PDZ 708 736 1e-5 BLAST
low complexity region 787 797 N/A INTRINSIC
low complexity region 864 878 N/A INTRINSIC
Blast:PDZ 1302 1331 2e-11 BLAST
PDZ 1413 1493 6.4e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000200196
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit limb grasping, reduced long term depression, increased anxiety, increased aggression towards other mice, impaired spatial memory, decreased prepulse inhibition, decreased nesting building behavior, and abnormal dendritic spines. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Gene trapped(2)

Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410137M14Rik G A 17: 36,978,902 S12L probably benign Het
4921507P07Rik G T 6: 50,595,828 T35K possibly damaging Het
4931406P16Rik T C 7: 34,284,773 M142V probably damaging Het
Abce1 A G 8: 79,687,486 V532A probably damaging Het
Adamts12 T A 15: 11,311,492 N1278K probably benign Het
Adipor1 T A 1: 134,424,905 I138N probably damaging Het
Aox2 C T 1: 58,304,597 Q480* probably null Het
Arhgef38 C T 3: 133,140,772 probably null Het
Atmin A G 8: 116,957,959 D786G probably damaging Het
Capn1 A T 19: 6,011,015 N253K probably benign Het
Cdh8 T C 8: 99,024,902 T728A possibly damaging Het
Celsr1 A G 15: 86,030,494 S1093P probably damaging Het
Cep135 C A 5: 76,616,854 P560T probably benign Het
Chfr C T 5: 110,144,867 Q167* probably null Het
Chrna4 A G 2: 181,037,493 S54P probably damaging Het
Cntln A G 4: 84,971,216 N312S probably benign Het
Cntn6 A G 6: 104,728,284 E154G probably benign Het
Col6a6 T A 9: 105,767,342 Y1249F possibly damaging Het
Cpsf2 T C 12: 101,983,207 S61P probably damaging Het
Cpvl C T 6: 53,931,933 E282K probably benign Het
Cryba2 C T 1: 74,890,048 D179N probably benign Het
Daglb A T 5: 143,503,349 R654W probably damaging Het
Dennd3 A G 15: 73,570,860 D1244G probably damaging Het
Dhx57 T C 17: 80,274,961 E405G probably damaging Het
Dnah10 T C 5: 124,828,472 M4060T possibly damaging Het
Dph1 A G 11: 75,181,330 S238P probably damaging Het
Duox1 C T 2: 122,319,475 P116S probably benign Het
Ebf1 A G 11: 44,991,557 N447D probably damaging Het
Epg5 A G 18: 78,012,864 N1751S probably benign Het
Exoc6 A G 19: 37,570,505 D75G probably damaging Het
Extl2 T A 3: 116,024,207 I70N probably damaging Het
Fam129c G T 8: 71,603,825 E390* probably null Het
Fanca T C 8: 123,268,972 T1364A probably damaging Het
Fbln7 T A 2: 128,894,910 probably null Het
Foxa3 G T 7: 19,014,372 C275* probably null Het
Foxred1 C T 9: 35,210,855 probably benign Het
Galr2 A G 11: 116,283,629 T362A probably benign Het
Garem2 C A 5: 30,114,667 R376S probably damaging Het
Gatc T A 5: 115,335,547 N111I probably benign Het
Gjb4 C A 4: 127,351,778 K123N probably damaging Het
Gm14025 T C 2: 129,038,230 H592R probably benign Het
Gm9894 T C 13: 67,765,094 noncoding transcript Het
Gtdc1 T C 2: 44,591,925 N301S probably benign Het
Gtf2ird1 T A 5: 134,383,902 E55V probably damaging Het
Gtsf1 T C 15: 103,421,205 I96V probably benign Het
Homer1 T A 13: 93,402,159 I170N probably damaging Het
Homer3 G A 8: 70,290,143 probably null Het
Hoxb9 A G 11: 96,274,831 K242R possibly damaging Het
Ifna14 T C 4: 88,571,336 R155G probably benign Het
Lsm11 A G 11: 45,933,813 S296P probably damaging Het
Macrod2 T C 2: 142,217,599 L265P probably damaging Het
Mcu G A 10: 59,456,699 L53F probably damaging Het
Mpv17l2 A G 8: 70,760,415 V104A possibly damaging Het
Myh10 G A 11: 68,801,730 probably null Het
Nemf T C 12: 69,312,280 E1031G probably damaging Het
Nhsl1 G A 10: 18,531,405 S1395N probably damaging Het
Nlrp2 T A 7: 5,319,189 I82F probably benign Het
Nlrp4e T A 7: 23,336,780 L686* probably null Het
Nudt12os T A 17: 59,024,551 noncoding transcript Het
Olfr1122 T A 2: 87,387,876 I57K probably damaging Het
Olfr16 G A 1: 172,957,590 S265N probably benign Het
Olfr180 T C 16: 58,916,584 D19G probably benign Het
Olfr205 A G 16: 59,329,210 Y100H possibly damaging Het
Olfr93 A T 17: 37,151,379 S44T possibly damaging Het
Olfr944 T A 9: 39,217,846 M163K probably damaging Het
Pde7a T C 3: 19,260,256 T59A probably damaging Het
Pde7b A C 10: 20,438,750 D203E probably damaging Het
Phkg2 T A 7: 127,577,984 I94N possibly damaging Het
Pik3r2 G A 8: 70,768,859 T667I possibly damaging Het
Pitx3 T A 19: 46,137,101 H68L possibly damaging Het
Prcd A G 11: 116,668,164 probably benign Het
Prune2 C T 19: 17,120,188 R1019* probably null Het
Psap A G 10: 60,300,545 D486G probably benign Het
Purb A T 11: 6,475,615 V91E probably damaging Het
Recql C A 6: 142,376,841 V112F probably damaging Het
Rptor A T 11: 119,743,882 I175F probably damaging Het
Sbf1 C T 15: 89,295,246 V1385M probably damaging Het
Serpinb13 C T 1: 106,982,844 S66L probably damaging Het
Slc35f6 T C 5: 30,655,613 L37P probably damaging Het
Slc6a3 T A 13: 73,538,581 N22K possibly damaging Het
Sorl1 A T 9: 42,004,051 M1294K probably damaging Het
Sp6 C A 11: 97,021,875 A138E probably benign Het
Spag8 G T 4: 43,653,408 probably benign Het
Spon1 T A 7: 114,028,969 M320K probably benign Het
Tceanc2 A T 4: 107,165,560 S77T probably damaging Het
Thsd7a T A 6: 12,337,314 T1235S possibly damaging Het
Thsd7a T A 6: 12,504,013 I381F possibly damaging Het
Tmc4 T C 7: 3,671,271 probably null Het
Tmprss11d T C 5: 86,309,401 D133G probably damaging Het
Trav13n-3 T A 14: 53,337,496 V65D probably damaging Het
Trpm1 G T 7: 64,203,034 L65F probably damaging Het
Tyk2 C T 9: 21,114,207 A741T probably damaging Het
Ube2v1 T A 2: 167,610,377 Y102F probably damaging Het
Uckl1 A T 2: 181,574,868 S95T possibly damaging Het
Uhrf1bp1 G T 17: 27,893,503 W1222L possibly damaging Het
Vcan C A 13: 89,679,934 W2171L probably damaging Het
Vmn1r64 T C 7: 5,884,358 N62S probably damaging Het
Vmn2r67 T C 7: 85,150,623 D469G probably benign Het
Vps13b A G 15: 35,640,544 S1352G probably benign Het
Zbtb38 C T 9: 96,688,383 R216H probably damaging Het
Other mutations in Lrrc7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00594:Lrrc7 APN 3 158187010 missense probably benign 0.07
IGL00644:Lrrc7 APN 3 158202368 nonsense probably null
IGL00822:Lrrc7 APN 3 158185474 missense probably damaging 0.99
IGL00927:Lrrc7 APN 3 158161090 missense possibly damaging 0.94
IGL00946:Lrrc7 APN 3 158161356 missense probably benign 0.07
IGL00948:Lrrc7 APN 3 158161557 missense probably damaging 1.00
IGL01838:Lrrc7 APN 3 158185463 missense probably damaging 1.00
IGL01874:Lrrc7 APN 3 158240443 splice site probably benign
IGL02514:Lrrc7 APN 3 158160292 missense probably damaging 0.96
IGL02545:Lrrc7 APN 3 158185374 splice site probably benign
IGL02665:Lrrc7 APN 3 158161105 missense probably damaging 0.99
IGL03129:Lrrc7 APN 3 158161059 missense probably benign 0.02
N/A:Lrrc7 UTSW 3 158160340 missense probably benign
R0021:Lrrc7 UTSW 3 158160661 missense probably damaging 1.00
R0041:Lrrc7 UTSW 3 158164260 splice site probably benign
R0255:Lrrc7 UTSW 3 158160838 nonsense probably null
R0278:Lrrc7 UTSW 3 158179795 missense possibly damaging 0.96
R0409:Lrrc7 UTSW 3 158161426 missense possibly damaging 0.59
R0612:Lrrc7 UTSW 3 158164353 missense probably damaging 0.98
R0866:Lrrc7 UTSW 3 158164266 splice site probably benign
R1077:Lrrc7 UTSW 3 158161143 missense probably damaging 1.00
R1103:Lrrc7 UTSW 3 158148706 splice site probably benign
R1157:Lrrc7 UTSW 3 158160255 missense probably damaging 1.00
R1187:Lrrc7 UTSW 3 158160402 missense probably damaging 1.00
R1301:Lrrc7 UTSW 3 158135331 missense probably benign 0.20
R1433:Lrrc7 UTSW 3 158177306 missense probably damaging 1.00
R1450:Lrrc7 UTSW 3 158187044 missense possibly damaging 0.62
R1595:Lrrc7 UTSW 3 158177277 nonsense probably null
R1659:Lrrc7 UTSW 3 158161408 missense probably damaging 1.00
R1693:Lrrc7 UTSW 3 158084533 missense possibly damaging 0.95
R1774:Lrrc7 UTSW 3 158160292 missense possibly damaging 0.88
R2273:Lrrc7 UTSW 3 158187059 missense probably damaging 1.00
R2276:Lrrc7 UTSW 3 158179792 missense probably damaging 1.00
R2302:Lrrc7 UTSW 3 158135244 missense probably damaging 0.99
R2326:Lrrc7 UTSW 3 158170661 missense probably damaging 1.00
R2371:Lrrc7 UTSW 3 158161060 missense probably damaging 0.99
R2383:Lrrc7 UTSW 3 158163956 missense probably benign
R2679:Lrrc7 UTSW 3 158175108 nonsense probably null
R2698:Lrrc7 UTSW 3 158135391 missense probably benign 0.22
R2858:Lrrc7 UTSW 3 158161725 missense probably damaging 0.99
R3758:Lrrc7 UTSW 3 158163965 missense probably damaging 1.00
R3791:Lrrc7 UTSW 3 158163956 missense probably benign
R3805:Lrrc7 UTSW 3 158185493 missense probably benign 0.10
R3806:Lrrc7 UTSW 3 158185493 missense probably benign 0.10
R3807:Lrrc7 UTSW 3 158185493 missense probably benign 0.10
R3892:Lrrc7 UTSW 3 158160696 missense probably benign 0.08
R3912:Lrrc7 UTSW 3 158291952 missense probably damaging 1.00
R3913:Lrrc7 UTSW 3 158291952 missense probably damaging 1.00
R3963:Lrrc7 UTSW 3 158160405 missense probably damaging 1.00
R4665:Lrrc7 UTSW 3 158318408 critical splice donor site probably benign
R4671:Lrrc7 UTSW 3 158202495 critical splice acceptor site probably null
R4688:Lrrc7 UTSW 3 158148605 missense probably damaging 1.00
R4725:Lrrc7 UTSW 3 158318408 critical splice donor site probably benign
R4726:Lrrc7 UTSW 3 158318408 critical splice donor site probably benign
R4728:Lrrc7 UTSW 3 158318408 critical splice donor site probably benign
R4783:Lrrc7 UTSW 3 158127213 critical splice donor site probably null
R4867:Lrrc7 UTSW 3 158161005 missense probably damaging 1.00
R4907:Lrrc7 UTSW 3 158161240 missense probably damaging 1.00
R5032:Lrrc7 UTSW 3 158181580 missense possibly damaging 0.85
R5107:Lrrc7 UTSW 3 158161896 missense probably damaging 1.00
R5295:Lrrc7 UTSW 3 158170739 missense probably damaging 1.00
R5348:Lrrc7 UTSW 3 158175326 missense probably benign 0.02
R5468:Lrrc7 UTSW 3 158318436 missense probably damaging 1.00
R5778:Lrrc7 UTSW 3 158170743 missense probably damaging 1.00
R5897:Lrrc7 UTSW 3 158164353 missense probably damaging 0.98
R6179:Lrrc7 UTSW 3 158353432 missense probably damaging 0.99
R6312:Lrrc7 UTSW 3 158160609 missense probably benign 0.04
R6313:Lrrc7 UTSW 3 158160736 missense probably damaging 1.00
R6366:Lrrc7 UTSW 3 158135375 missense probably benign 0.04
R6389:Lrrc7 UTSW 3 158185426 missense probably damaging 1.00
R6638:Lrrc7 UTSW 3 158135303 missense probably benign 0.20
R6956:Lrrc7 UTSW 3 158289031 missense probably benign 0.02
R6969:Lrrc7 UTSW 3 158156913 missense probably benign 0.19
R7073:Lrrc7 UTSW 3 158127247 missense probably damaging 1.00
R7313:Lrrc7 UTSW 3 158160474 missense probably damaging 1.00
R7365:Lrrc7 UTSW 3 158198161 missense probably damaging 1.00
R7398:Lrrc7 UTSW 3 158291958 nonsense probably null
R7403:Lrrc7 UTSW 3 158148674 nonsense probably null
R7407:Lrrc7 UTSW 3 158135241 missense probably damaging 1.00
R7427:Lrrc7 UTSW 3 158198141 missense probably benign 0.06
R7453:Lrrc7 UTSW 3 158185409 missense probably benign 0.00
R7461:Lrrc7 UTSW 3 158187020 missense probably benign 0.00
R7807:Lrrc7 UTSW 3 158160487 missense probably damaging 1.00
R7872:Lrrc7 UTSW 3 158353462 missense probably damaging 0.99
R8215:Lrrc7 UTSW 3 158209750 missense probably benign
R8367:Lrrc7 UTSW 3 158202370 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- GCTCTGAAAATGAGGATGAACC -3'
(R):5'- TAAGTGAGTCTAGCCAAACTGTG -3'

Sequencing Primer
(F):5'- CTAGTAGAGGATGCAAAATGGTTTAG -3'
(R):5'- CCAAACTGTGGCCTAACTAGTGAG -3'
Posted On2017-12-01