Incidental Mutation 'R4661:Zfp248'
ID500761
Institutional Source Beutler Lab
Gene Symbol Zfp248
Ensembl Gene ENSMUSG00000030145
Gene Namezinc finger protein 248
SynonymsE130106N01Rik, 2810037F07Rik
MMRRC Submission 041600-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R4661 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location118427319-118455528 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 118433307 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 47 (V47E)
Ref Sequence ENSEMBL: ENSMUSP00000068807 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069292] [ENSMUST00000159403] [ENSMUST00000161519]
Predicted Effect possibly damaging
Transcript: ENSMUST00000069292
AA Change: V47E

PolyPhen 2 Score 0.842 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000068807
Gene: ENSMUSG00000030145
AA Change: V47E

DomainStartEndE-ValueType
KRAB 8 68 2.4e-35 SMART
internal_repeat_1 209 375 2.52e-18 PROSPERO
ZnF_C2H2 377 399 3.89e-3 SMART
ZnF_C2H2 405 427 3.95e-4 SMART
ZnF_C2H2 433 455 4.24e-4 SMART
ZnF_C2H2 461 483 8.94e-3 SMART
ZnF_C2H2 489 511 8.47e-4 SMART
ZnF_C2H2 517 539 8.02e-5 SMART
ZnF_C2H2 545 567 6.52e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159403
Predicted Effect probably benign
Transcript: ENSMUST00000161519
SMART Domains Protein: ENSMUSP00000124539
Gene: ENSMUSG00000030145

DomainStartEndE-ValueType
Pfam:zf-C2H2_6 165 188 3.3e-2 PFAM
ZnF_C2H2 276 298 3.89e-3 SMART
ZnF_C2H2 304 326 3.95e-4 SMART
ZnF_C2H2 332 354 4.24e-4 SMART
ZnF_C2H2 360 382 8.94e-3 SMART
ZnF_C2H2 388 410 8.47e-4 SMART
ZnF_C2H2 416 438 8.02e-5 SMART
ZnF_C2H2 444 466 6.52e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162275
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175338
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg4 T C 9: 44,287,330 N42D probably damaging Het
Adamdec1 G A 14: 68,570,113 T366I probably damaging Het
Adamts7 C A 9: 90,193,330 H1038Q probably benign Het
Aff3 T C 1: 38,627,128 D5G possibly damaging Het
Amhr2 A T 15: 102,454,253 D485V probably damaging Het
Arhgap35 A T 7: 16,564,738 F134Y probably damaging Het
Asxl3 A G 18: 22,516,477 T508A probably benign Het
Atp10a TGGCGGCGGC TGGCGGC 7: 58,658,500 probably benign Het
Atp4a G A 7: 30,720,225 R671Q probably benign Het
Atp9a A G 2: 168,637,672 F928L possibly damaging Het
BC034090 A T 1: 155,232,475 D13E probably damaging Het
Bco1 A G 8: 117,129,241 E425G probably benign Het
Brsk1 T C 7: 4,707,299 S436P possibly damaging Het
C1s1 T C 6: 124,536,490 I193V probably benign Het
Calb2 A G 8: 110,168,077 F21L probably benign Het
Catsperz T G 19: 6,924,803 T108P probably benign Het
Cep57l1 T A 10: 41,719,771 D329V possibly damaging Het
Cfdp1 A G 8: 111,830,945 F188S probably benign Het
Chrna2 G A 14: 66,148,843 G146D probably damaging Het
Col6a1 A C 10: 76,714,672 F520V unknown Het
Cyb5d2 C A 11: 72,778,945 V43L probably damaging Het
Cyp2c40 T C 19: 39,786,846 T321A probably benign Het
Dnajc16 A C 4: 141,763,548 Y764D probably damaging Het
Dsg1a G A 18: 20,340,533 V888M probably damaging Het
F5 A C 1: 164,184,920 T468P probably damaging Het
Faap24 A G 7: 35,395,084 M97T probably benign Het
Fam227b A T 2: 126,007,310 I334N probably damaging Het
Frem2 G T 3: 53,655,443 P548T probably damaging Het
Gfm1 A G 3: 67,433,398 E94G probably damaging Het
Gm17606 A T 14: 54,648,239 probably benign Het
Gnb2 A T 5: 137,530,253 M1K probably null Het
Gys1 G A 7: 45,454,834 A544T probably damaging Het
Hdac5 T C 11: 102,205,849 Y230C probably damaging Het
Hunk A T 16: 90,447,308 probably null Het
Ifnl2 A G 7: 28,510,210 F51L probably damaging Het
Itpr1 T C 6: 108,410,931 probably null Het
Kcnj1 A G 9: 32,396,622 Y114C probably benign Het
Kdm4b T A 17: 56,399,459 S322T probably damaging Het
Kif27 T C 13: 58,323,916 E786G probably damaging Het
Kif6 T C 17: 49,753,881 V414A probably benign Het
L1td1 A G 4: 98,733,624 K141R possibly damaging Het
Loxhd1 A G 18: 77,402,885 I1394V possibly damaging Het
Lrfn5 A T 12: 61,839,647 M74L probably damaging Het
Lrp6 C T 6: 134,511,267 D289N probably benign Het
Mroh7 A G 4: 106,691,513 probably null Het
Muc4 A C 16: 32,769,277 E2885A possibly damaging Het
Myo18b G T 5: 112,875,175 probably benign Het
Ncln G A 10: 81,493,068 A172V probably damaging Het
Nek9 G A 12: 85,320,892 T335M possibly damaging Het
Notch2 A G 3: 98,135,513 Y1398C probably damaging Het
Olfr472 A T 7: 107,902,981 H88L probably benign Het
Olfr710 T A 7: 106,944,867 I45F probably damaging Het
Olfr981 A T 9: 40,022,527 I45F probably damaging Het
Pax2 G A 19: 44,760,937 V40M probably damaging Het
Pde6c A G 19: 38,169,439 Y637C probably damaging Het
Plppr5 A G 3: 117,620,969 I80V probably damaging Het
Pold1 G T 7: 44,532,809 P1100T probably damaging Het
Prune2 T C 19: 17,000,023 Y41H probably damaging Het
Rgl2 C T 17: 33,933,226 A329V possibly damaging Het
Rilp T A 11: 75,511,424 Y250N probably damaging Het
Rilpl1 A G 5: 124,514,688 V19A probably benign Het
Rtp3 T C 9: 110,986,451 probably null Het
Rufy4 A G 1: 74,133,107 K246E probably damaging Het
Saraf C A 8: 34,168,462 A306E probably damaging Het
Slc26a8 A T 17: 28,638,684 N828K probably benign Het
Src C T 2: 157,469,932 P527S probably damaging Het
Susd3 C T 13: 49,231,302 probably null Het
Syngap1 T C 17: 26,966,906 L1270P probably damaging Het
Taf1c G A 8: 119,598,850 P758S probably damaging Het
Tenm2 A T 11: 36,024,448 N2087K probably damaging Het
Tfrc A T 16: 32,630,151 I703F probably damaging Het
Thap1 C G 8: 26,160,846 T48S probably benign Het
Tspear T C 10: 77,866,329 F199L probably benign Het
Usp17lc A T 7: 103,418,590 H364L probably benign Het
Usp9x A G X: 13,123,508 R776G possibly damaging Homo
Vmn1r1 T C 1: 182,157,224 E292G possibly damaging Het
Vmn1r125 T G 7: 21,272,627 V150G probably damaging Het
Vmn1r167 A T 7: 23,504,692 L300I probably damaging Het
Vmn2r106 A C 17: 20,267,623 I838S probably benign Het
Wdr64 A T 1: 175,726,494 S197C probably damaging Het
Other mutations in Zfp248
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00582:Zfp248 APN 6 118429732 missense probably damaging 1.00
IGL02268:Zfp248 APN 6 118453840 intron probably benign
R1374:Zfp248 UTSW 6 118433373 missense probably damaging 1.00
R1678:Zfp248 UTSW 6 118429804 missense probably benign 0.02
R1794:Zfp248 UTSW 6 118429303 missense probably damaging 1.00
R1834:Zfp248 UTSW 6 118428970 missense probably damaging 0.98
R3900:Zfp248 UTSW 6 118429566 missense probably damaging 1.00
R3948:Zfp248 UTSW 6 118430194 frame shift probably null
R4810:Zfp248 UTSW 6 118429846 missense possibly damaging 0.68
R4924:Zfp248 UTSW 6 118429072 missense probably damaging 1.00
R4926:Zfp248 UTSW 6 118429826 missense possibly damaging 0.74
R7326:Zfp248 UTSW 6 118430209 missense probably damaging 1.00
R7357:Zfp248 UTSW 6 118429657 missense probably damaging 1.00
R7910:Zfp248 UTSW 6 118430142 missense possibly damaging 0.93
R7991:Zfp248 UTSW 6 118430142 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- CTGTTCTCAACCTTCTACATAGAGG -3'
(R):5'- GCCTCAGCACTATTCGCAAC -3'

Sequencing Primer
(F):5'- CCTTCTACATAGAGGTGAAAATACAC -3'
(R):5'- TGCCCAGAAGGTGCTTTA -3'
Posted On2017-12-01