Incidental Mutation 'R3732:Ugcg'
ID 500778
Institutional Source Beutler Lab
Gene Symbol Ugcg
Ensembl Gene ENSMUSG00000028381
Gene Name UDP-glucose ceramide glucosyltransferase
Synonyms Epcs21, Ugcgl, GlcT-1
MMRRC Submission 040720-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R3732 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 59189257-59222833 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 59207798 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Proline to Serine at position 46 (P46S)
Ref Sequence ENSEMBL: ENSMUSP00000030074 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030074]
AlphaFold O88693
Predicted Effect probably benign
Transcript: ENSMUST00000030074
AA Change: P46S

PolyPhen 2 Score 0.175 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000030074
Gene: ENSMUSG00000028381
AA Change: P46S

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 51 278 1.3e-26 PFAM
Pfam:Glyco_transf_21 106 278 8.4e-61 PFAM
Pfam:Glyco_trans_2_3 139 368 9.6e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128227
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133996
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155153
Meta Mutation Damage Score 0.0799 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency 93% (56/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that catalyzes the first glycosylation step in the biosynthesis of glycosphingolipids, which are membrane components containing lipid and sugar moieties. The product of this reaction is glucosylceramide, which is the core structure of many glycosphingolipids. [provided by RefSeq, Dec 2014]
PHENOTYPE: At embryonic day 7.5, embryos homozygous for a null mutation exhibit decreased size, markedly reduced extraembryonic tissues and a large increase in cells undergoing apoptosis. Mutants die by embryonic day 8.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006E09Rik C T 11: 101,988,452 Q17* probably null Het
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
Aacs C T 5: 125,506,262 T294M probably damaging Het
Ablim1 A T 19: 57,049,460 probably null Het
Adgrf4 C T 17: 42,672,581 G70E probably damaging Het
Adgrl3 C A 5: 81,794,946 H1474Q probably benign Het
Adgrv1 T C 13: 81,556,956 I1578M probably damaging Het
Afg3l1 G A 8: 123,501,233 G547D probably damaging Het
Ambra1 G A 2: 91,810,131 R635H probably damaging Het
Araf TACACACACACACACACA TACACACACACACACA X: 20,850,226 probably benign Het
Arhgef10l AGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGA 4: 140,581,619 probably benign Het
Bcl7b A G 5: 135,180,913 T141A probably benign Het
Calm5 T A 13: 3,854,337 N10K probably damaging Het
Camsap1 T C 2: 25,938,344 R1123G probably damaging Het
Chrna3 T C 9: 55,015,894 K210R probably benign Het
Ciz1 A G 2: 32,367,483 N180S possibly damaging Het
Cntnap3 G A 13: 64,740,999 A1162V possibly damaging Het
Cox5b C T 1: 36,693,260 P114L probably damaging Het
Cpsf2 T C 12: 101,987,308 I199T probably damaging Het
Cyp2a4 A G 7: 26,312,827 D345G probably damaging Het
Cyp2s1 C T 7: 25,803,954 R424Q probably null Het
D1Pas1 C A 1: 186,968,097 S74R probably benign Het
Ddx4 T A 13: 112,611,982 I487F possibly damaging Het
Dnah5 A T 15: 28,409,122 E3562V possibly damaging Het
Dpf3 T C 12: 83,269,507 D330G possibly damaging Het
Edem1 T C 6: 108,841,621 F197L probably damaging Het
Ergic2 T C 6: 148,202,522 D79G probably damaging Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Fam102a G A 2: 32,566,292 S322N probably benign Het
Fam111a T C 19: 12,587,550 L221P possibly damaging Het
Fat1 T C 8: 44,953,269 V1019A possibly damaging Het
Fbxl21 T A 13: 56,527,017 H60Q probably benign Het
Fbxw7 A C 3: 84,925,707 K19Q possibly damaging Het
Gldn A G 9: 54,338,662 K499R possibly damaging Het
Gm5514 T G 19: 21,938,252 noncoding transcript Het
Gria4 C T 9: 4,513,295 M271I probably benign Het
Herc1 C T 9: 66,445,640 T2136I probably damaging Het
Igsf10 A G 3: 59,325,714 F1866S probably benign Het
Iqcg G T 16: 33,053,626 probably benign Het
Itih2 A T 2: 10,105,670 F537I probably benign Het
Itpr2 T C 6: 146,382,700 D533G probably damaging Het
Kcnk15 A G 2: 163,853,813 K22E probably benign Het
Lag3 A T 6: 124,910,140 S155T probably benign Het
Lars T C 18: 42,212,602 E1003G probably benign Het
Layn T A 9: 51,059,544 N233I probably damaging Het
Lgi1 T C 19: 38,306,246 Y465H probably damaging Het
Lrig1 C T 6: 94,611,576 A531T possibly damaging Het
Lrrtm4 A G 6: 80,019,655 probably benign Het
Lsamp T A 16: 42,144,572 L264H probably damaging Het
Mthfd2 T C 6: 83,313,475 E39G probably damaging Het
Mtx2 C A 2: 74,847,262 A22E probably damaging Het
Nipal3 T C 4: 135,463,846 T325A probably damaging Het
Nlrp14 A T 7: 107,182,367 Y257F probably benign Het
Ola1 G C 2: 73,156,860 R143G probably damaging Het
Olfr301 T G 7: 86,412,633 I90M probably damaging Het
Otog A G 7: 46,288,368 T1834A probably benign Het
Oxr1 T C 15: 41,848,701 I656T probably damaging Het
Panx1 GTTCTTCT GTTCT 9: 15,006,171 probably benign Het
Pcdh18 T C 3: 49,754,791 S692G probably benign Het
Pcdhga1 A G 18: 37,664,123 T727A probably benign Het
Pde9a A G 17: 31,448,427 E3G possibly damaging Het
Prl8a1 T C 13: 27,579,733 E37G probably damaging Het
Rlf C T 4: 121,148,324 G1153D probably benign Het
Robo2 A C 16: 73,920,747 L1159W possibly damaging Het
Sfxn5 T C 6: 85,299,276 probably benign Het
Siah2 A G 3: 58,676,250 V205A probably damaging Het
Spindoc A C 19: 7,374,301 L202R probably damaging Het
Spock3 T A 8: 63,345,699 D251E probably damaging Het
Srp68 T A 11: 116,273,956 K51* probably null Het
Ssbp2 T C 13: 91,524,607 Y29H probably damaging Het
Sspo T C 6: 48,449,930 V231A probably damaging Het
Stk4 T A 2: 164,088,908 M143K probably benign Het
Tecta C T 9: 42,392,106 V77M possibly damaging Het
Trpc3 A T 3: 36,638,559 D761E probably benign Het
Tubb2a T C 13: 34,075,264 E181G probably damaging Het
Ush2a C A 1: 188,944,760 N4756K probably benign Het
Vmn2r-ps159 G T 4: 156,334,397 noncoding transcript Het
Wapl G A 14: 34,736,764 V928I probably damaging Het
Zfand3 A G 17: 30,192,656 K130R probably benign Het
Zfp934 A T 13: 62,517,785 H347Q probably damaging Het
Other mutations in Ugcg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01447:Ugcg APN 4 59213865 missense possibly damaging 0.94
IGL01768:Ugcg APN 4 59217216 critical splice donor site probably null
IGL02636:Ugcg APN 4 59207763 missense possibly damaging 0.73
IGL02672:Ugcg APN 4 59218587 splice site probably benign
IGL02798:Ugcg APN 4 59220346 missense probably damaging 1.00
congee UTSW 4 59207798 missense probably benign 0.17
cream_o_wheat UTSW 4 59220387 missense possibly damaging 0.91
gruel UTSW 4 59189690 missense probably benign
Porridge UTSW 4 59219530 missense possibly damaging 0.86
slop UTSW 4 59211883 missense probably benign 0.16
wheatina UTSW 4 59220272 missense probably damaging 0.96
PIT4382001:Ugcg UTSW 4 59213246 missense possibly damaging 0.68
R0013:Ugcg UTSW 4 59213931 missense possibly damaging 0.82
R0013:Ugcg UTSW 4 59213931 missense possibly damaging 0.82
R0068:Ugcg UTSW 4 59217130 missense probably benign 0.16
R0068:Ugcg UTSW 4 59217130 missense probably benign 0.16
R0119:Ugcg UTSW 4 59217036 missense possibly damaging 0.85
R0230:Ugcg UTSW 4 59189739 nonsense probably null
R0299:Ugcg UTSW 4 59217036 missense possibly damaging 0.85
R0384:Ugcg UTSW 4 59220387 missense possibly damaging 0.91
R0499:Ugcg UTSW 4 59217036 missense possibly damaging 0.85
R0645:Ugcg UTSW 4 59207798 missense probably benign 0.17
R0688:Ugcg UTSW 4 59207798 missense probably benign 0.17
R0726:Ugcg UTSW 4 59207798 missense probably benign 0.17
R0802:Ugcg UTSW 4 59189685 missense probably benign 0.00
R0803:Ugcg UTSW 4 59189685 missense probably benign 0.00
R0811:Ugcg UTSW 4 59207798 missense probably benign 0.17
R0812:Ugcg UTSW 4 59207798 missense probably benign 0.17
R0828:Ugcg UTSW 4 59207798 missense probably benign 0.17
R0831:Ugcg UTSW 4 59207798 missense probably benign 0.17
R0944:Ugcg UTSW 4 59207798 missense probably benign 0.17
R0945:Ugcg UTSW 4 59207798 missense probably benign 0.17
R0947:Ugcg UTSW 4 59207798 missense probably benign 0.17
R1104:Ugcg UTSW 4 59207798 missense probably benign 0.17
R1209:Ugcg UTSW 4 59207798 missense probably benign 0.17
R1210:Ugcg UTSW 4 59207798 missense probably benign 0.17
R1252:Ugcg UTSW 4 59207798 missense probably benign 0.17
R1253:Ugcg UTSW 4 59207798 missense probably benign 0.17
R1255:Ugcg UTSW 4 59207798 missense probably benign 0.17
R1488:Ugcg UTSW 4 59207798 missense probably benign 0.17
R1490:Ugcg UTSW 4 59207798 missense probably benign 0.17
R1548:Ugcg UTSW 4 59207798 missense probably benign 0.17
R1698:Ugcg UTSW 4 59207798 missense probably benign 0.17
R1771:Ugcg UTSW 4 59207775 missense probably benign 0.05
R1776:Ugcg UTSW 4 59207775 missense probably benign 0.05
R1781:Ugcg UTSW 4 59207798 missense probably benign 0.17
R1794:Ugcg UTSW 4 59207798 missense probably benign 0.17
R1840:Ugcg UTSW 4 59219517 missense probably damaging 1.00
R1942:Ugcg UTSW 4 59207798 missense probably benign 0.17
R2228:Ugcg UTSW 4 59207798 missense probably benign 0.17
R2229:Ugcg UTSW 4 59207798 missense probably benign 0.17
R2237:Ugcg UTSW 4 59207798 missense probably benign 0.17
R2239:Ugcg UTSW 4 59207798 missense probably benign 0.17
R2314:Ugcg UTSW 4 59207798 missense probably benign 0.17
R2337:Ugcg UTSW 4 59207798 missense probably benign 0.17
R2338:Ugcg UTSW 4 59207798 missense probably benign 0.17
R2340:Ugcg UTSW 4 59207798 missense probably benign 0.17
R2422:Ugcg UTSW 4 59207798 missense probably benign 0.17
R2426:Ugcg UTSW 4 59207798 missense probably benign 0.17
R2433:Ugcg UTSW 4 59207876 missense possibly damaging 0.89
R2680:Ugcg UTSW 4 59207798 missense probably benign 0.17
R3076:Ugcg UTSW 4 59213922 missense probably damaging 1.00
R3078:Ugcg UTSW 4 59213922 missense probably damaging 1.00
R3689:Ugcg UTSW 4 59211883 missense probably benign 0.16
R3732:Ugcg UTSW 4 59207798 missense probably benign 0.17
R3733:Ugcg UTSW 4 59207798 missense probably benign 0.17
R3766:Ugcg UTSW 4 59207798 missense probably benign 0.17
R3767:Ugcg UTSW 4 59207798 missense probably benign 0.17
R3768:Ugcg UTSW 4 59207798 missense probably benign 0.17
R3769:Ugcg UTSW 4 59207798 missense probably benign 0.17
R3771:Ugcg UTSW 4 59189690 missense probably benign
R3847:Ugcg UTSW 4 59207798 missense probably benign 0.17
R3848:Ugcg UTSW 4 59207798 missense probably benign 0.17
R3916:Ugcg UTSW 4 59207798 missense probably benign 0.17
R3917:Ugcg UTSW 4 59207798 missense probably benign 0.17
R3958:Ugcg UTSW 4 59207798 missense probably benign 0.17
R3959:Ugcg UTSW 4 59207798 missense probably benign 0.17
R4023:Ugcg UTSW 4 59207798 missense probably benign 0.17
R4024:Ugcg UTSW 4 59207798 missense probably benign 0.17
R4025:Ugcg UTSW 4 59207798 missense probably benign 0.17
R4065:Ugcg UTSW 4 59207798 missense probably benign 0.17
R4066:Ugcg UTSW 4 59207798 missense probably benign 0.17
R4427:Ugcg UTSW 4 59219555 missense probably benign 0.02
R5842:Ugcg UTSW 4 59219545 missense possibly damaging 0.93
R6012:Ugcg UTSW 4 59220272 missense probably damaging 0.96
R6080:Ugcg UTSW 4 59218524 missense possibly damaging 0.70
R6762:Ugcg UTSW 4 59219530 missense possibly damaging 0.86
R7194:Ugcg UTSW 4 59213210 missense probably damaging 0.99
R7286:Ugcg UTSW 4 59217111 missense possibly damaging 0.95
R7362:Ugcg UTSW 4 59217109 missense probably damaging 1.00
R7472:Ugcg UTSW 4 59217156 missense probably benign
R7638:Ugcg UTSW 4 59220299 missense probably benign 0.26
R7866:Ugcg UTSW 4 59211927 missense possibly damaging 0.71
R8170:Ugcg UTSW 4 59211974 missense possibly damaging 0.71
R8488:Ugcg UTSW 4 59213896 missense probably benign 0.00
R8793:Ugcg UTSW 4 59207794 missense probably benign 0.22
R9441:Ugcg UTSW 4 59207843 missense probably damaging 1.00
Y4336:Ugcg UTSW 4 59207798 missense probably benign 0.17
Y4337:Ugcg UTSW 4 59207798 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- TCTTGCTCCTGGTTCTTGTGTTT -3'
(R):5'- AGGCTAGGCTGTTTTCACAATCA -3'

Sequencing Primer
(F):5'- TCTAACCCAACTCTGTTCAG -3'
(R):5'- CACGTATTCTTTCATTCCCC -3'
Posted On 2017-12-01