Incidental Mutation 'R4905:Myh11'
ID500814
Institutional Source Beutler Lab
Gene Symbol Myh11
Ensembl Gene ENSMUSG00000018830
Gene Namemyosin, heavy polypeptide 11, smooth muscle
SynonymssmMHC, SM1, SM2
Accession Numbers

Genbank: NM_013607, NM_001161775

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4905 (G1)
Quality Score220
Status Not validated
Chromosome16
Chromosomal Location14194535-14291372 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 14250523 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 211 (T211M)
Ref Sequence ENSEMBL: ENSMUSP00000155052 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090287] [ENSMUST00000230397] [ENSMUST00000231567]
Predicted Effect probably benign
Transcript: ENSMUST00000090287
AA Change: T211M

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000087756
Gene: ENSMUSG00000018830
AA Change: T211M

DomainStartEndE-ValueType
Pfam:Myosin_N 33 73 1e-15 PFAM
MYSc 79 784 N/A SMART
IQ 785 807 1.09e-2 SMART
Pfam:Myosin_tail_1 848 1928 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000230397
AA Change: T211M

PolyPhen 2 Score 0.127 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230643
Predicted Effect probably benign
Transcript: ENSMUST00000231567
AA Change: T211M

PolyPhen 2 Score 0.073 (Sensitivity: 0.93; Specificity: 0.84)
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.0%
  • 20x: 87.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a smooth muscle myosin belonging to the myosin heavy chain family. The gene product is a subunit of a hexameric protein that consists of two heavy chain subunits and two pairs of non-identical light chain subunits. It functions as a major contractile protein, converting chemical energy into mechanical energy through the hydrolysis of ATP. The gene encoding a human ortholog of rat NUDE1 is transcribed from the reverse strand of this gene, and its 3' end overlaps with that of the latter. The pericentric inversion of chromosome 16 [inv(16)(p13q22)] produces a chimeric transcript that encodes a protein consisting of the first 165 residues from the N terminus of core-binding factor beta in a fusion with the C-terminal portion of the smooth muscle myosin heavy chain. This chromosomal rearrangement is associated with acute myeloid leukemia of the M4Eo subtype. Alternative splicing generates isoforms that are differentially expressed, with ratios changing during muscle cell maturation. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice have impaired smooth muscle contractility. They are incapable of urinating, exhibit dilative cardiomyopathy, are growth retarded, and die within 3 days of birth. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, knock-out(4)

Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik A T 10: 100,612,818 probably null Het
1700123L14Rik T A 6: 96,165,930 R44S possibly damaging Het
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
9530053A07Rik A T 7: 28,156,983 K2065M possibly damaging Het
Abcc5 A G 16: 20,399,928 S235P probably damaging Het
Abcc6 T C 7: 45,995,225 N842S probably benign Het
Acbd6 G A 1: 155,624,923 V210I probably benign Het
Ahctf1 A T 1: 179,748,627 V2130D probably damaging Het
Akap5 A G 12: 76,328,433 E213G probably damaging Het
Alyref T G 11: 120,596,053 probably null Het
Anapc5 G T 5: 122,817,910 N152K probably benign Het
Atp8b2 A T 3: 89,949,008 D416E probably benign Het
AW551984 A T 9: 39,597,158 V354E probably damaging Het
Bag6 A G 17: 35,145,186 E844G probably damaging Het
Bmp1 C T 14: 70,491,362 R590H probably benign Het
Ccnh T C 13: 85,206,135 S233P possibly damaging Het
Cdca7 TGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGA TGAAGAAGAAGAAGAAGAAGAAGAAGAAGA 2: 72,481,861 probably benign Het
Col6a6 A G 9: 105,767,424 S1222P probably damaging Het
Dhfr G A 13: 92,365,774 G118S probably damaging Het
Dnah9 G A 11: 65,874,124 R1414* probably null Het
Dnaic1 A G 4: 41,614,269 D315G probably benign Het
Eogt T C 6: 97,142,831 R139G probably benign Het
Fh1 C T 1: 175,619,073 G79E probably damaging Het
Gabrg3 A G 7: 56,724,556 Y421H probably damaging Het
Glipr1 C A 10: 111,985,640 R219L probably damaging Het
Gm1123 T C 9: 99,009,316 D360G probably benign Het
Ift81 C T 5: 122,591,079 probably null Het
Itsn2 A G 12: 4,634,583 probably benign Het
Kri1 A T 9: 21,287,702 H55Q probably benign Het
Mcidas C A 13: 112,994,417 A92E possibly damaging Het
Mcidas C T 13: 112,997,504 T174M possibly damaging Het
Mmp25 C A 17: 23,644,048 G130* probably null Het
Myo10 A G 15: 25,800,212 D1458G probably damaging Het
Ncf4 A G 15: 78,254,904 T154A probably damaging Het
Nfatc4 T C 14: 55,830,582 I620T probably benign Het
Nos3 A T 5: 24,367,331 Y134F probably benign Het
Olfr1459 C A 19: 13,146,177 A161S probably benign Het
Olfr273 T C 4: 52,855,613 N300S probably damaging Het
Olfr575 A T 7: 102,955,514 I36N probably damaging Het
Olfr799 T A 10: 129,647,923 V265E possibly damaging Het
Pax9 G T 12: 56,696,626 R19S probably damaging Het
Pcdha9 T C 18: 36,998,892 I338T probably damaging Het
Plxnb2 G T 15: 89,157,411 T1730K probably damaging Het
Rac1 A G 5: 143,517,152 probably null Het
Samsn1 G T 16: 75,876,465 F174L possibly damaging Het
Scaf1 G A 7: 45,012,705 T86M probably damaging Het
Smc1b A G 15: 85,066,227 Y1199H probably damaging Het
Svep1 A G 4: 58,069,308 I2826T probably benign Het
Tex36 A G 7: 133,587,453 V130A probably damaging Het
Tigd5 A G 15: 75,911,403 H538R probably damaging Het
Tlr3 C A 8: 45,399,223 probably null Het
Tubb2b A T 13: 34,128,204 I202N probably damaging Het
Unc13c A G 9: 73,680,392 V1453A probably benign Het
Unc5c A T 3: 141,801,310 T608S probably benign Het
Vrk1 C A 12: 106,051,828 H119N probably damaging Het
Wdr53 T A 16: 32,256,658 M227K probably benign Het
Xpo4 T C 14: 57,638,289 D129G possibly damaging Het
Zcchc4 T C 5: 52,796,650 I224T probably damaging Het
Zdhhc1 T A 8: 105,483,694 E30D probably damaging Het
Zscan29 C G 2: 121,161,383 R540T possibly damaging Het
Other mutations in Myh11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01362:Myh11 APN 16 14277722 missense probably benign 0.00
IGL01398:Myh11 APN 16 14202100 missense probably damaging 0.99
IGL01646:Myh11 APN 16 14221775 missense probably damaging 1.00
IGL02470:Myh11 APN 16 14218046 missense probably damaging 1.00
IGL02680:Myh11 APN 16 14209520 missense probably benign 0.02
IGL02687:Myh11 APN 16 14212618 nonsense probably null
IGL02987:Myh11 APN 16 14232532 missense probably damaging 1.00
IGL03008:Myh11 APN 16 14204753 missense probably benign 0.00
G5030:Myh11 UTSW 16 14250579 missense probably damaging 1.00
PIT4618001:Myh11 UTSW 16 14201066 missense
R0008:Myh11 UTSW 16 14224019 missense probably damaging 1.00
R0085:Myh11 UTSW 16 14224019 missense probably damaging 1.00
R0086:Myh11 UTSW 16 14224019 missense probably damaging 1.00
R0087:Myh11 UTSW 16 14224019 missense probably damaging 1.00
R0096:Myh11 UTSW 16 14204367 missense possibly damaging 0.94
R0096:Myh11 UTSW 16 14204367 missense possibly damaging 0.94
R0207:Myh11 UTSW 16 14211260 missense possibly damaging 0.95
R0326:Myh11 UTSW 16 14218880 missense probably benign 0.32
R0546:Myh11 UTSW 16 14205628 missense probably damaging 1.00
R0658:Myh11 UTSW 16 14224019 missense probably damaging 1.00
R0715:Myh11 UTSW 16 14226616 missense possibly damaging 0.89
R0839:Myh11 UTSW 16 14203178 missense probably damaging 1.00
R1014:Myh11 UTSW 16 14236410 missense possibly damaging 0.70
R1104:Myh11 UTSW 16 14202127 missense possibly damaging 0.53
R1426:Myh11 UTSW 16 14205931 nonsense probably null
R1560:Myh11 UTSW 16 14226620 nonsense probably null
R1714:Myh11 UTSW 16 14236368 critical splice donor site probably null
R1742:Myh11 UTSW 16 14220044 missense probably damaging 1.00
R1750:Myh11 UTSW 16 14200758 missense probably damaging 1.00
R1750:Myh11 UTSW 16 14215790 missense probably damaging 0.98
R1753:Myh11 UTSW 16 14277870 missense probably benign
R1760:Myh11 UTSW 16 14233695 splice site probably benign
R1829:Myh11 UTSW 16 14223880 missense probably damaging 1.00
R1876:Myh11 UTSW 16 14269103 splice site probably benign
R2027:Myh11 UTSW 16 14232668 missense probably damaging 1.00
R2122:Myh11 UTSW 16 14218004 missense probably damaging 1.00
R2247:Myh11 UTSW 16 14277559 missense probably damaging 1.00
R2495:Myh11 UTSW 16 14205557 missense probably damaging 1.00
R2863:Myh11 UTSW 16 14239426 missense probably benign 0.02
R3684:Myh11 UTSW 16 14203234 missense probably benign 0.00
R3693:Myh11 UTSW 16 14217949 missense probably benign 0.01
R4080:Myh11 UTSW 16 14224059 missense possibly damaging 0.83
R4367:Myh11 UTSW 16 14218883 missense probably damaging 0.97
R4664:Myh11 UTSW 16 14226584 missense possibly damaging 0.70
R4673:Myh11 UTSW 16 14269241 missense probably damaging 0.99
R4694:Myh11 UTSW 16 14200702 missense probably damaging 1.00
R4805:Myh11 UTSW 16 14234465 missense possibly damaging 0.61
R4806:Myh11 UTSW 16 14201083 splice site probably null
R4939:Myh11 UTSW 16 14239507 missense probably benign
R4964:Myh11 UTSW 16 14205954 missense probably damaging 1.00
R4966:Myh11 UTSW 16 14205954 missense probably damaging 1.00
R5029:Myh11 UTSW 16 14205625 missense probably damaging 1.00
R5045:Myh11 UTSW 16 14239527 nonsense probably null
R5097:Myh11 UTSW 16 14205906 splice site probably null
R5288:Myh11 UTSW 16 14208008 missense possibly damaging 0.66
R5385:Myh11 UTSW 16 14208008 missense possibly damaging 0.66
R5621:Myh11 UTSW 16 14244855 missense probably damaging 0.96
R5856:Myh11 UTSW 16 14205976 missense probably benign 0.00
R5869:Myh11 UTSW 16 14230800 missense probably damaging 1.00
R6019:Myh11 UTSW 16 14206074 missense probably damaging 1.00
R6024:Myh11 UTSW 16 14277703 missense probably damaging 0.99
R6139:Myh11 UTSW 16 14215874 missense probably damaging 1.00
R6209:Myh11 UTSW 16 14208291 nonsense probably null
R6373:Myh11 UTSW 16 14205130 missense possibly damaging 0.72
R6671:Myh11 UTSW 16 14226616 missense possibly damaging 0.89
R6688:Myh11 UTSW 16 14205553 missense probably damaging 1.00
R6709:Myh11 UTSW 16 14223494 critical splice donor site probably null
R7069:Myh11 UTSW 16 14218939 missense possibly damaging 0.95
R7176:Myh11 UTSW 16 14215826 missense
R7644:Myh11 UTSW 16 14221824 missense
R7838:Myh11 UTSW 16 14209617 missense
R7905:Myh11 UTSW 16 14207681 nonsense probably null
R7921:Myh11 UTSW 16 14209617 missense
R7988:Myh11 UTSW 16 14207681 nonsense probably null
X0018:Myh11 UTSW 16 14277633 missense probably damaging 1.00
X0025:Myh11 UTSW 16 14209689 missense possibly damaging 0.93
X0027:Myh11 UTSW 16 14234402 missense probably damaging 1.00
Z1088:Myh11 UTSW 16 14269262 frame shift probably null
Z1176:Myh11 UTSW 16 14239396 missense probably null
Z1176:Myh11 UTSW 16 14277775 missense
Z1177:Myh11 UTSW 16 14209595 missense
Predicted Primers PCR Primer
(F):5'- TGCTAAGAAGTGCTCACCGC -3'
(R):5'- TAAATGCCCCTGCTAGGAGG -3'

Sequencing Primer
(F):5'- TCACCGCAGATCTCAGTGGAG -3'
(R):5'- CCCCTGCTAGGAGGAGTTTTG -3'
Posted On2017-12-01