Incidental Mutation 'R4925:Tnni2'
ID 500821
Institutional Source Beutler Lab
Gene Symbol Tnni2
Ensembl Gene ENSMUSG00000031097
Gene Name troponin I, skeletal, fast 2
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R4925 (G1)
Quality Score 224
Status Not validated
Chromosome 7
Chromosomal Location 142441808-142444410 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 142442693 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Valine at position 4 (E4V)
Ref Sequence ENSEMBL: ENSMUSP00000122733 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097939] [ENSMUST00000105971] [ENSMUST00000105973] [ENSMUST00000105976] [ENSMUST00000105977] [ENSMUST00000118276] [ENSMUST00000122393] [ENSMUST00000145287] [ENSMUST00000149529] [ENSMUST00000210239] [ENSMUST00000210746]
AlphaFold P13412
Predicted Effect probably benign
Transcript: ENSMUST00000097939
SMART Domains Protein: ENSMUSP00000095552
Gene: ENSMUSG00000031098

DomainStartEndE-ValueType
transmembrane domain 37 59 N/A INTRINSIC
C2 123 222 1.86e-15 SMART
C2 251 361 8.69e-16 SMART
low complexity region 380 388 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105971
AA Change: E4V

PolyPhen 2 Score 0.246 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000101591
Gene: ENSMUSG00000031097
AA Change: E4V

DomainStartEndE-ValueType
Pfam:Troponin 15 145 1.1e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105973
SMART Domains Protein: ENSMUSP00000101593
Gene: ENSMUSG00000031097

DomainStartEndE-ValueType
Pfam:Troponin 10 153 1.9e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105976
SMART Domains Protein: ENSMUSP00000101596
Gene: ENSMUSG00000031098

DomainStartEndE-ValueType
transmembrane domain 37 59 N/A INTRINSIC
C2 123 222 1.86e-15 SMART
C2 251 361 8.69e-16 SMART
low complexity region 380 388 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105977
SMART Domains Protein: ENSMUSP00000101597
Gene: ENSMUSG00000031098

DomainStartEndE-ValueType
Pfam:UPF0560 14 88 2.7e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118276
SMART Domains Protein: ENSMUSP00000113545
Gene: ENSMUSG00000031098

DomainStartEndE-ValueType
transmembrane domain 43 65 N/A INTRINSIC
C2 129 228 1.86e-15 SMART
C2 257 367 8.69e-16 SMART
low complexity region 386 394 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000122393
SMART Domains Protein: ENSMUSP00000112689
Gene: ENSMUSG00000031098

DomainStartEndE-ValueType
transmembrane domain 43 65 N/A INTRINSIC
C2 129 228 1.86e-15 SMART
C2 257 367 8.69e-16 SMART
low complexity region 386 394 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124963
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128481
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129618
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131034
Predicted Effect probably benign
Transcript: ENSMUST00000145287
AA Change: E4V

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000121819
Gene: ENSMUSG00000031097
AA Change: E4V

DomainStartEndE-ValueType
Pfam:Troponin 15 135 4.2e-49 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145964
Predicted Effect probably benign
Transcript: ENSMUST00000149529
AA Change: E4V

PolyPhen 2 Score 0.246 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000122733
Gene: ENSMUSG00000031097
AA Change: E4V

DomainStartEndE-ValueType
Pfam:Troponin 15 145 1.1e-54 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211192
Predicted Effect probably benign
Transcript: ENSMUST00000210239
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148896
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150192
Predicted Effect probably benign
Transcript: ENSMUST00000210746
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.0%
  • 20x: 87.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a fast-twitch skeletal muscle protein, a member of the troponin I gene family, and a component of the troponin complex including troponin T, troponin C and troponin I subunits. The troponin complex, along with tropomyosin, is responsible for the calcium-dependent regulation of striated muscle contraction. Mouse studies show that this component is also present in vascular smooth muscle and may play a role in regulation of smooth muscle function. In addition to muscle tissues, this protein is found in corneal epithelium, cartilage where it is an inhibitor of angiogenesis to inhibit tumor growth and metastasis, and mammary gland where it functions as a co-activator of estrogen receptor-related receptor alpha. This protein also suppresses tumor growth in human ovarian carcinoma. Mutations in this gene cause myopathy and distal arthrogryposis type 2B. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Mar 2009]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810065E05Rik T A 11: 58,425,714 C173* probably null Het
2210407C18Rik T A 11: 58,610,687 T157S probably damaging Het
3425401B19Rik T A 14: 32,663,180 H276L possibly damaging Het
4930430A15Rik T C 2: 111,218,616 K273E probably benign Het
Adam21 T G 12: 81,560,389 M200L probably benign Het
Adamts3 A T 5: 89,684,323 S974T probably benign Het
Adamtsl3 T A 7: 82,602,299 probably null Het
Atp8b2 A G 3: 89,946,623 probably null Het
Brd8 T C 18: 34,607,335 T552A probably benign Het
Btaf1 A G 19: 37,011,333 S1826G probably benign Het
C330027C09Rik T C 16: 49,016,363 probably null Het
Ccdc163 A G 4: 116,711,331 E77G possibly damaging Het
Ces2g A G 8: 104,964,894 R194G probably benign Het
Cln8 A G 8: 14,895,004 H106R possibly damaging Het
Col12a1 T G 9: 79,674,795 L1391F probably damaging Het
Col16a1 G A 4: 130,054,176 D230N probably damaging Het
Crhbp C A 13: 95,443,810 G87V possibly damaging Het
Cyp3a16 C T 5: 145,452,834 M240I probably benign Het
Cyp4a14 A T 4: 115,495,936 W60R possibly damaging Het
Fam47e A G 5: 92,585,290 Y304C probably damaging Het
Fgfbp1 A T 5: 43,979,292 D219E probably damaging Het
Fgfr2 A T 7: 130,185,272 Y485N probably damaging Het
Fhdc1 C T 3: 84,453,533 V363M probably damaging Het
Foxb1 T A 9: 69,760,155 E31V probably damaging Het
Galnt9 T C 5: 110,544,739 V13A possibly damaging Het
Ghrl T C 6: 113,716,257 D77G probably damaging Het
Gm21731 A G 13: 120,240,848 Y60C probably damaging Het
Gpr85 A G 6: 13,835,978 V309A probably benign Het
Greb1 T C 12: 16,681,471 Y1622C probably damaging Het
Greb1l T A 18: 10,547,447 M1555K possibly damaging Het
Grin2a T A 16: 9,669,823 N404Y probably damaging Het
Gtpbp1 A C 15: 79,715,968 I399L probably benign Het
Hectd4 T C 5: 121,322,690 S911P possibly damaging Het
Igkc A T 6: 70,726,536 K34* probably null Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Iqgap1 T A 7: 80,765,317 I149F probably damaging Het
Lama1 C T 17: 67,794,314 A1934V probably benign Het
Lrp1 C A 10: 127,575,075 E1415* probably null Het
Macf1 A C 4: 123,526,652 C270G probably benign Het
Marveld3 A G 8: 109,948,311 V291A probably benign Het
Med23 T C 10: 24,910,747 F917S probably damaging Het
Mfng C T 15: 78,764,388 R163H probably benign Het
Ncan A T 8: 70,109,954 D551E probably benign Het
Olfr1269 T A 2: 90,118,777 T274S probably damaging Het
Olfr382 A T 11: 73,517,172 I9N possibly damaging Het
Olfr649 T C 7: 104,190,180 Y9C possibly damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pla2g12a T C 3: 129,878,818 W34R probably damaging Het
Plekha7 A G 7: 116,158,128 F529S probably damaging Het
Ppl T A 16: 5,104,982 D215V probably damaging Het
Pramef20 A T 4: 144,377,932 M1K probably null Het
Prdm1 T A 10: 44,440,169 Y690F probably damaging Het
Prkcd T A 14: 30,607,613 D124V probably damaging Het
Ptprc C A 1: 138,099,497 D538Y probably benign Het
Rasl10b G A 11: 83,412,679 V21M probably damaging Het
Rgsl1 T A 1: 153,812,277 Y657F probably benign Het
Rrn3 T C 16: 13,799,972 C360R probably damaging Het
Scarb1 T C 5: 125,297,299 T257A probably damaging Het
Serpinb2 T A 1: 107,515,489 M6K probably benign Het
Slco4a1 T C 2: 180,472,056 Y429H probably benign Het
St13 G C 15: 81,399,585 R4G probably benign Het
Taar3 T A 10: 23,950,543 F329Y probably damaging Het
Tardbp A T 4: 148,618,651 N285K probably benign Het
Tnpo2 A T 8: 85,050,025 I454F probably damaging Het
Tpr T G 1: 150,432,565 H1690Q probably benign Het
Trav18 T C 14: 53,831,120 S6P probably benign Het
Trf T C 9: 103,219,246 N25S probably benign Het
Vmn1r59 T C 7: 5,454,116 N215S probably benign Het
Vmn2r2 T C 3: 64,137,471 M1V probably null Het
Wdr64 T C 1: 175,724,702 probably null Het
Wdr73 T C 7: 80,893,195 S222G probably benign Het
Other mutations in Tnni2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02272:Tnni2 APN 7 142443429 missense possibly damaging 0.83
R5213:Tnni2 UTSW 7 142443302 splice site probably null
R5646:Tnni2 UTSW 7 142443913 missense probably damaging 1.00
R6643:Tnni2 UTSW 7 142444279 missense probably damaging 1.00
R7385:Tnni2 UTSW 7 142443178 missense probably benign
R8037:Tnni2 UTSW 7 142443954 missense probably damaging 1.00
R9002:Tnni2 UTSW 7 142444276 missense probably damaging 1.00
R9335:Tnni2 UTSW 7 142444266 missense probably damaging 0.99
R9339:Tnni2 UTSW 7 142443935 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCAGAGCTTGAGATCTCAGGATG -3'
(R):5'- TGATTCCCTTGTGACTAGGCCC -3'

Sequencing Primer
(F):5'- AGTAAGTGATACCCAGGGTGACC -3'
(R):5'- GTGACTAGGCCCAAGTCTTAC -3'
Posted On 2017-12-01