Incidental Mutation 'R4913:Map2k4'
ID500829
Institutional Source Beutler Lab
Gene Symbol Map2k4
Ensembl Gene ENSMUSG00000033352
Gene Namemitogen-activated protein kinase kinase 4
SynonymsSerk1, MKK4, Sek1, JNKK1
MMRRC Submission 042515-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4913 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location65688243-65788297 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 65709932 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Tyrosine at position 58 (D58Y)
Ref Sequence ENSEMBL: ENSMUSP00000137656 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046963] [ENSMUST00000125598] [ENSMUST00000130009] [ENSMUST00000140301] [ENSMUST00000152096]
Predicted Effect probably damaging
Transcript: ENSMUST00000046963
AA Change: D227Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000041282
Gene: ENSMUSG00000033352
AA Change: D227Y

DomainStartEndE-ValueType
low complexity region 2 28 N/A INTRINSIC
S_TKc 100 365 9.38e-79 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000125598
AA Change: D58Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000137656
Gene: ENSMUSG00000033352
AA Change: D58Y

DomainStartEndE-ValueType
Pfam:Pkinase 34 128 8.4e-27 PFAM
Pfam:Kinase-like 36 128 8.9e-8 PFAM
Pfam:Pkinase_Tyr 37 129 6.3e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130009
SMART Domains Protein: ENSMUSP00000137819
Gene: ENSMUSG00000033352

DomainStartEndE-ValueType
low complexity region 2 28 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140301
SMART Domains Protein: ENSMUSP00000137955
Gene: ENSMUSG00000033352

DomainStartEndE-ValueType
low complexity region 2 28 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000152096
SMART Domains Protein: ENSMUSP00000114219
Gene: ENSMUSG00000033352

DomainStartEndE-ValueType
low complexity region 2 28 N/A INTRINSIC
Pfam:Pkinase_Tyr 111 202 2.5e-9 PFAM
Pfam:Pkinase 111 204 1e-13 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.0%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the mitogen-activated protein kinase (MAPK) family. Members of this family act as an integration point for multiple biochemical signals and are involved in a wide variety of cellular processes such as proliferation, differentiation, transcription regulation, and development. They form a three-tiered signaling module composed of MAPKKKs, MAPKKs, and MAPKs. This protein is phosphorylated at serine and threonine residues by MAPKKKs and subsequently phosphorylates downstream MAPK targets at threonine and tyrosine residues. A similar protein in mouse has been reported to play a role in liver organogenesis. A pseudogene of this gene is located on the long arm of chromosome X. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygotes for targeted null mutations exhibit abnormal liver development with a deficiency of parenchymal hepatocytes, severe anemia, and lethality before embryonic day 14.0. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik C G 6: 149,329,389 S1311C probably damaging Het
9430007A20Rik T A 4: 144,528,811 M267K possibly damaging Het
Acsm5 T C 7: 119,534,343 S244P probably damaging Het
Actr6 A G 10: 89,714,946 F329L probably benign Het
Actrt3 A G 3: 30,598,439 S169P probably benign Het
Agtpbp1 C A 13: 59,500,072 G645C probably damaging Het
AI661453 C T 17: 47,468,555 R1069* probably null Het
Akr1c6 T C 13: 4,454,525 I303T probably benign Het
Arnt A G 3: 95,490,654 R588G probably damaging Het
Atf1 A G 15: 100,252,098 probably null Het
BC052040 A G 2: 115,670,087 probably null Het
Casp12 T C 9: 5,358,726 V318A probably damaging Het
Cblb C T 16: 52,166,029 P545L possibly damaging Het
Cc2d2a A T 5: 43,739,323 I1521F probably benign Het
Ccnb1ip1 T A 14: 50,792,144 K154* probably null Het
Cd300a A T 11: 114,893,372 K69* probably null Het
Clec10a A G 11: 70,170,025 Y78C probably damaging Het
Cnot1 T C 8: 95,763,067 I503V possibly damaging Het
Cpa2 A G 6: 30,554,293 H304R probably damaging Het
Crb2 A T 2: 37,790,245 H395L probably benign Het
Ctgf T C 10: 24,597,327 C255R probably damaging Het
Dnah8 T A 17: 30,819,139 N4257K probably damaging Het
Dnase2a G A 8: 84,908,848 D25N probably damaging Het
Drd1 T C 13: 54,053,167 T343A probably benign Het
Emid1 G A 11: 5,132,012 T161I probably benign Het
Epn2 A G 11: 61,534,576 probably null Het
Esp36 A T 17: 38,417,164 N75K possibly damaging Het
Faf1 A G 4: 109,935,549 S573G possibly damaging Het
Fam149a T G 8: 45,353,883 S231R probably damaging Het
Fam78a T C 2: 32,069,762 E112G probably damaging Het
Fgf18 T C 11: 33,134,316 D46G probably benign Het
Fggy G A 4: 95,697,076 probably null Het
Foxb1 T C 9: 69,759,577 M224V probably benign Het
Gpr75 T C 11: 30,891,808 C238R possibly damaging Het
Gsdmc3 A G 15: 63,858,273 *481R probably null Het
H2afv C A 11: 6,433,750 A57S probably damaging Het
Hsd17b11 T C 5: 103,992,882 I250V probably benign Het
Hus1 C A 11: 8,996,856 L280F probably benign Het
Ide A T 19: 37,329,070 H101Q unknown Het
Ido1 T C 8: 24,584,517 D279G probably benign Het
Inpp5b T C 4: 124,780,421 V307A probably benign Het
Ipo5 G A 14: 120,935,086 V519I probably damaging Het
Krba1 T C 6: 48,406,957 V239A probably benign Het
Lmod3 A G 6: 97,247,164 probably null Het
Macf1 T C 4: 123,499,889 D836G probably damaging Het
Malt1 G T 18: 65,476,280 C774F probably damaging Het
Mc2r T C 18: 68,407,340 N294S probably benign Het
Mybpc1 A G 10: 88,553,254 probably null Het
Mybpc3 A G 2: 91,126,264 E637G possibly damaging Het
Narf A G 11: 121,244,643 Q107R probably damaging Het
Nlrp3 G A 11: 59,549,238 G547D probably benign Het
Nucb2 G T 7: 116,524,305 G51* probably null Het
Olfr121 T A 17: 37,752,424 V190D possibly damaging Het
Otog C A 7: 46,264,102 D786E probably benign Het
Otogl T C 10: 107,876,855 T543A probably damaging Het
Phf20l1 A G 15: 66,604,855 N266S probably benign Het
Pink1 G T 4: 138,315,555 S446* probably null Het
Pkp4 T G 2: 59,305,450 H186Q probably damaging Het
Prl3b1 T C 13: 27,249,477 V205A probably damaging Het
Prss32 T C 17: 23,859,183 V281A probably damaging Het
Psd3 C T 8: 68,121,169 C120Y probably damaging Het
Ptcra A G 17: 46,758,648 L99P probably damaging Het
Rab3gap2 C T 1: 185,262,829 T855I probably benign Het
Rabgap1l T C 1: 160,238,541 E199G probably damaging Het
Rbm44 T A 1: 91,155,494 C580S probably damaging Het
Rhoq T C 17: 86,995,065 V143A probably benign Het
Sacs T A 14: 61,213,797 Y4431N probably benign Het
Sec24b A T 3: 130,002,379 S367T probably benign Het
Sema4c G A 1: 36,550,185 S620F probably benign Het
Slc12a1 G A 2: 125,228,750 G1054E probably damaging Het
Slc16a3 A G 11: 120,957,968 R417G probably benign Het
Slc22a29 A T 19: 8,218,358 S106T probably benign Het
Slc41a2 T C 10: 83,313,420 T220A probably damaging Het
Tap1 T C 17: 34,193,494 F474L possibly damaging Het
Tas2r106 G T 6: 131,678,459 A143D probably benign Het
Tbx6 A T 7: 126,784,535 probably null Het
Tfap2a T A 13: 40,717,230 N402I probably damaging Het
Tle3 T A 9: 61,373,993 V22E probably damaging Het
Tmem8 T C 17: 26,120,539 F584L probably damaging Het
Trip4 T C 9: 65,858,357 I353M probably damaging Het
Ubr2 C A 17: 46,959,459 probably null Het
Ugdh A G 5: 65,423,448 probably null Het
Uhrf1 T C 17: 56,315,478 V431A probably damaging Het
Usp5 C G 6: 124,822,630 K318N possibly damaging Het
Zfp820 T C 17: 21,819,219 K376R probably benign Het
Other mutations in Map2k4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00534:Map2k4 APN 11 65719479 splice site probably benign
IGL01318:Map2k4 APN 11 65756263 splice site probably benign
IGL02500:Map2k4 APN 11 65696310 missense probably damaging 1.00
IGL02628:Map2k4 APN 11 65690741 missense possibly damaging 0.83
IGL02873:Map2k4 APN 11 65719574 missense probably damaging 0.97
IGL03124:Map2k4 APN 11 65690791 missense probably damaging 0.98
R0021:Map2k4 UTSW 11 65712284 missense probably damaging 1.00
R0021:Map2k4 UTSW 11 65712284 missense probably damaging 1.00
R0034:Map2k4 UTSW 11 65719611 splice site probably benign
R0034:Map2k4 UTSW 11 65719611 splice site probably benign
R0646:Map2k4 UTSW 11 65712275 missense probably damaging 1.00
R2073:Map2k4 UTSW 11 65693456 missense probably damaging 0.99
R2931:Map2k4 UTSW 11 65756337 missense probably damaging 0.99
R3800:Map2k4 UTSW 11 65690781 nonsense probably null
R4820:Map2k4 UTSW 11 65696375 splice site probably benign
R5452:Map2k4 UTSW 11 65719587 missense probably damaging 0.97
R5497:Map2k4 UTSW 11 65735205 missense probably damaging 1.00
R5812:Map2k4 UTSW 11 65735205 missense probably damaging 1.00
R5976:Map2k4 UTSW 11 65709952 missense probably benign 0.31
R6282:Map2k4 UTSW 11 65707016 missense possibly damaging 0.78
R6505:Map2k4 UTSW 11 65693529 missense possibly damaging 0.63
R6784:Map2k4 UTSW 11 65691751 unclassified probably benign
R7560:Map2k4 UTSW 11 65775757 missense unknown
Predicted Primers PCR Primer
(F):5'- CAGGAAGGAGTCTAAGCATAACACC -3'
(R):5'- AGGCAGCTTGTCAGATGTAAAATTG -3'

Sequencing Primer
(F):5'- GCATAACACCGCCCCCTTTC -3'
(R):5'- CATACAGAGAGCTTTGAAGG -3'
Posted On2017-12-01