Incidental Mutation 'R0543:Hars2'
ID50083
Institutional Source Beutler Lab
Gene Symbol Hars2
Ensembl Gene ENSMUSG00000019143
Gene Namehistidyl-tRNA synthetase 2
SynonymsHarsl, HARSR, HO3
MMRRC Submission 038735-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.955) question?
Stock #R0543 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location36783008-36792562 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 36789424 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 337 (E337K)
Ref Sequence ENSEMBL: ENSMUSP00000117231 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001419] [ENSMUST00000019287] [ENSMUST00000152954]
Predicted Effect probably benign
Transcript: ENSMUST00000001419
SMART Domains Protein: ENSMUSP00000001419
Gene: ENSMUSG00000001383

DomainStartEndE-ValueType
ZnF_U1 77 111 2.41e-11 SMART
ZnF_C2H2 80 104 5.48e0 SMART
coiled coil region 118 180 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000019287
SMART Domains Protein: ENSMUSP00000019287
Gene: ENSMUSG00000019143

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:tRNA-synt_His 61 313 1.3e-23 PFAM
Pfam:tRNA-synt_2b 72 234 2.8e-21 PFAM
Pfam:HGTP_anticodon2 324 424 2.7e-8 PFAM
Pfam:HGTP_anticodon 329 420 2e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124204
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131952
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134122
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145876
Predicted Effect probably damaging
Transcript: ENSMUST00000152954
AA Change: E337K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117231
Gene: ENSMUSG00000019143
AA Change: E337K

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:tRNA-synt_His 61 389 1e-38 PFAM
Pfam:HGTP_anticodon 410 501 1.8e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155842
Meta Mutation Damage Score 0.2580 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.3%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: This gene encodes a putative member of the class II family of aminoacyl-tRNA synthetases. These enzymes play a critical role in protein biosynthesis by charging tRNAs with their cognate amino acids. This protein is encoded by the nuclear genome but is likely to be imported to the mitochondrion where it is thought to catalyze the ligation of histidine to tRNA molecules. Mutations in a similar gene in human have been associated with Perrault syndrome 2 (PRLTS2). [provided by RefSeq, Mar 2015]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1500015O10Rik C A 1: 43,742,289 N110K possibly damaging Het
4930444G20Rik T C 10: 22,066,924 S386G possibly damaging Het
4932438A13Rik G A 3: 36,996,458 S2981N probably benign Het
Alox5 T A 6: 116,454,317 probably null Het
Apol9b A G 15: 77,735,640 N212S probably damaging Het
Ash1l T A 3: 89,063,778 probably null Het
Ccdc180 A T 4: 45,900,041 K200* probably null Het
Ccser2 A T 14: 36,940,192 M345K probably benign Het
Cdcp2 A T 4: 107,097,676 probably null Het
Clca3a1 T C 3: 144,748,394 probably benign Het
Cntn3 G A 6: 102,269,090 probably benign Het
Col28a1 T A 6: 8,075,326 probably benign Het
Dock2 A G 11: 34,294,325 F1035S probably damaging Het
Dsg1a A T 18: 20,340,863 S998C probably damaging Het
Enox1 T C 14: 77,506,959 probably benign Het
Fgfr3 A G 5: 33,729,710 M1V probably null Het
Fuca2 T A 10: 13,503,126 Y5N probably damaging Het
Git2 G T 5: 114,745,531 H42Q probably damaging Het
Gm7964 G A 7: 83,756,394 noncoding transcript Het
Hells A G 19: 38,967,750 R797G probably benign Het
Hnf1a G A 5: 114,950,744 S571L probably benign Het
Hoxa5 T C 6: 52,204,340 Y4C probably damaging Het
Inpp4a G A 1: 37,369,492 probably benign Het
Ints6 T C 14: 62,696,611 I816V probably damaging Het
Itpr1 T C 6: 108,515,748 probably benign Het
Kcnt2 C A 1: 140,609,614 P1037T probably damaging Het
Lyg2 T A 1: 37,911,107 M47L possibly damaging Het
Macf1 G T 4: 123,376,378 A4648D probably damaging Het
Mcf2l T C 8: 12,996,728 probably null Het
Mcm9 C T 10: 53,541,598 R3H probably damaging Het
Met T A 6: 17,491,970 Y244N probably damaging Het
Mettl14 A T 3: 123,374,762 C210S possibly damaging Het
Mrgpra4 T C 7: 47,981,310 Y181C probably benign Het
Mtch2 T C 2: 90,849,682 V86A possibly damaging Het
Mttp A T 3: 138,111,696 I446N possibly damaging Het
Muc4 T A 16: 32,756,746 S2207T unknown Het
Muc5b A G 7: 141,851,785 T944A unknown Het
Myo15 A T 11: 60,479,051 H879L probably benign Het
Nkiras2 G A 11: 100,624,192 probably benign Het
Nostrin T G 2: 69,189,131 *507E probably null Het
Nup205 T C 6: 35,198,969 V589A probably benign Het
Olfr1141 C A 2: 87,753,650 L114F probably damaging Het
Olfr1444 G T 19: 12,861,888 V38F probably benign Het
Olfr530 A G 7: 140,373,394 I72T probably benign Het
Oxct2b T A 4: 123,116,989 M234K possibly damaging Het
Park2 G A 17: 11,067,179 D20N probably damaging Het
Pcdha1 A T 18: 37,185,068 I945F probably damaging Het
Pdzd3 A C 9: 44,248,934 H324Q probably damaging Het
Pik3ca G A 3: 32,450,261 probably null Het
Pkhd1l1 A G 15: 44,523,491 probably null Het
Plscr1 A T 9: 92,258,046 probably null Het
Psd T C 19: 46,319,517 E684G possibly damaging Het
Rab11fip3 T C 17: 25,994,225 E870G probably damaging Het
Rpl22l1 C A 3: 28,807,274 Y103* probably null Het
Slc38a4 A T 15: 97,016,839 N44K possibly damaging Het
Slco6c1 T A 1: 97,127,898 I93F probably damaging Het
Ssfa2 T A 2: 79,644,506 S270T possibly damaging Het
Strip1 G A 3: 107,626,775 T181M possibly damaging Het
Stxbp5l G A 16: 37,208,096 A535V probably damaging Het
Tg A T 15: 66,729,597 Q152L probably benign Het
Thada T C 17: 84,423,163 T1036A probably damaging Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Tns1 T A 1: 73,952,697 T941S probably benign Het
Tppp3 T C 8: 105,468,208 D97G probably benign Het
Trp53bp1 C A 2: 121,251,868 A317S probably null Het
Trpm7 T C 2: 126,848,529 I210V probably damaging Het
Ubr1 A G 2: 120,881,093 L1440P probably damaging Het
Utp18 A T 11: 93,875,835 Y317N probably damaging Het
Zdhhc5 T A 2: 84,692,480 probably benign Het
Zfp719 A G 7: 43,589,253 probably null Het
Other mutations in Hars2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00715:Hars2 APN 18 36785936 missense probably damaging 1.00
IGL00955:Hars2 APN 18 36789357 splice site probably benign
IGL01570:Hars2 APN 18 36787592 missense probably benign 0.04
IGL01618:Hars2 APN 18 36789577 nonsense probably null
IGL02165:Hars2 APN 18 36783394 start codon destroyed probably null 1.00
IGL02290:Hars2 APN 18 36785626 missense possibly damaging 0.56
IGL02685:Hars2 APN 18 36791118 missense probably benign 0.18
IGL02805:Hars2 APN 18 36787577 nonsense probably null
IGL02971:Hars2 APN 18 36786178 missense probably damaging 1.00
IGL03373:Hars2 APN 18 36785945 missense probably damaging 0.99
R0196:Hars2 UTSW 18 36789204 nonsense probably null
R0549:Hars2 UTSW 18 36786208 critical splice donor site probably null
R0557:Hars2 UTSW 18 36791077 missense possibly damaging 0.94
R0893:Hars2 UTSW 18 36787595 missense possibly damaging 0.56
R1188:Hars2 UTSW 18 36787969 missense probably damaging 0.99
R1289:Hars2 UTSW 18 36783412 unclassified probably null
R1381:Hars2 UTSW 18 36789217 missense possibly damaging 0.68
R2401:Hars2 UTSW 18 36789523 missense possibly damaging 0.95
R4119:Hars2 UTSW 18 36790488 missense probably damaging 0.98
R4351:Hars2 UTSW 18 36786178 missense probably damaging 1.00
R4404:Hars2 UTSW 18 36785936 missense probably damaging 1.00
R5372:Hars2 UTSW 18 36790481 missense possibly damaging 0.93
R5629:Hars2 UTSW 18 36788666 nonsense probably null
R5886:Hars2 UTSW 18 36790097 intron probably benign
R7069:Hars2 UTSW 18 36787956 missense probably damaging 0.99
R7070:Hars2 UTSW 18 36791112 nonsense probably null
R7188:Hars2 UTSW 18 36790561 missense probably benign 0.08
R7683:Hars2 UTSW 18 36788236 missense probably damaging 1.00
R7834:Hars2 UTSW 18 36789581 missense probably damaging 0.98
R7903:Hars2 UTSW 18 36786192 missense probably damaging 1.00
R7917:Hars2 UTSW 18 36789581 missense probably damaging 0.98
R7986:Hars2 UTSW 18 36786192 missense probably damaging 1.00
RF015:Hars2 UTSW 18 36785945 missense probably damaging 0.99
Z1177:Hars2 UTSW 18 36789575 missense probably damaging 1.00
Z1177:Hars2 UTSW 18 36790598 missense possibly damaging 0.84
Predicted Primers PCR Primer
(F):5'- ACCTGAAGCTGCTCTTTGAATACCTG -3'
(R):5'- CCTTTGCAGTAGCAATTCCAAAAGGC -3'

Sequencing Primer
(F):5'- GAATACCTGAGGTTATTTGGAATTGC -3'
(R):5'- TCTTAGCCTTCAGGGGCAC -3'
Posted On2013-06-12