Incidental Mutation 'R4931:Dhx9'
ID500838
Institutional Source Beutler Lab
Gene Symbol Dhx9
Ensembl Gene ENSMUSG00000042699
Gene NameDEAH (Asp-Glu-Ala-His) box polypeptide 9
Synonymsleukophysin, Ddx9, RNA helicase, nuclear DNA helicase II, NDHII, NDH II, RHA
MMRRC Submission 042532-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4931 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location153455758-153487660 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 153472673 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 302 (P302L)
Ref Sequence ENSEMBL: ENSMUSP00000139825 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042141] [ENSMUST00000186380] [ENSMUST00000186966] [ENSMUST00000188345]
Predicted Effect probably benign
Transcript: ENSMUST00000042141
AA Change: P303L

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000038135
Gene: ENSMUSG00000042699
AA Change: P303L

DomainStartEndE-ValueType
DSRM 4 70 2.23e-17 SMART
low complexity region 80 91 N/A INTRINSIC
low complexity region 93 120 N/A INTRINSIC
DSRM 184 254 3.52e-15 SMART
low complexity region 284 299 N/A INTRINSIC
low complexity region 334 349 N/A INTRINSIC
DEXDc 389 576 1.61e-25 SMART
low complexity region 592 608 N/A INTRINSIC
HELICc 667 772 4.69e-18 SMART
HA2 834 922 1.33e-24 SMART
Pfam:OB_NTP_bind 961 1077 1.6e-18 PFAM
low complexity region 1173 1309 N/A INTRINSIC
low complexity region 1313 1337 N/A INTRINSIC
low complexity region 1339 1384 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186380
AA Change: P302L

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000139825
Gene: ENSMUSG00000042699
AA Change: P302L

DomainStartEndE-ValueType
DSRM 4 70 1.3e-19 SMART
low complexity region 80 91 N/A INTRINSIC
low complexity region 93 120 N/A INTRINSIC
DSRM 183 253 2.1e-17 SMART
low complexity region 283 298 N/A INTRINSIC
low complexity region 333 348 N/A INTRINSIC
DEXDc 388 575 6.6e-28 SMART
low complexity region 591 607 N/A INTRINSIC
HELICc 666 771 1.9e-20 SMART
HA2 833 921 9.9e-29 SMART
Pfam:OB_NTP_bind 960 1076 5e-13 PFAM
low complexity region 1172 1308 N/A INTRINSIC
low complexity region 1312 1336 N/A INTRINSIC
low complexity region 1338 1383 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186966
AA Change: P302L

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000139806
Gene: ENSMUSG00000042699
AA Change: P302L

DomainStartEndE-ValueType
DSRM 4 70 1.3e-19 SMART
low complexity region 80 91 N/A INTRINSIC
low complexity region 93 120 N/A INTRINSIC
DSRM 183 253 2.1e-17 SMART
low complexity region 283 298 N/A INTRINSIC
low complexity region 333 348 N/A INTRINSIC
Blast:DEXDc 349 451 1e-37 BLAST
PDB:3LLM|B 349 456 2e-55 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000188345
AA Change: P303L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000139827
Gene: ENSMUSG00000042699
AA Change: P303L

DomainStartEndE-ValueType
DSRM 4 70 1.3e-19 SMART
low complexity region 80 91 N/A INTRINSIC
low complexity region 93 120 N/A INTRINSIC
DSRM 184 254 2.1e-17 SMART
low complexity region 284 299 N/A INTRINSIC
low complexity region 334 349 N/A INTRINSIC
DEXDc 389 576 6.6e-28 SMART
low complexity region 592 608 N/A INTRINSIC
Pfam:Helicase_C 678 735 6.4e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189509
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189516
Predicted Effect probably benign
Transcript: ENSMUST00000190544
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.7%
Validation Efficiency 95% (78/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DEAH-containing family of RNA helicases. The encoded protein is an enzyme that catalyzes the ATP-dependent unwinding of double-stranded RNA and DNA-RNA complexes. This protein localizes to both the nucleus and the cytoplasm and functions as a transcriptional regulator. This protein may also be involved in the expression and nuclear export of retroviral RNAs. Alternate splicing results in multiple transcript variants. Pseudogenes of this gene are found on chromosomes 11 and 13.[provided by RefSeq, Feb 2010]
PHENOTYPE: Homozygotes die in embryonic stages with massive apoptotic cell death in embryonic ectodermal cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410004B18Rik A G 3: 145,938,120 D21G probably benign Het
4930402H24Rik A G 2: 130,741,873 F496L possibly damaging Het
4930562C15Rik T C 16: 4,861,046 L68P possibly damaging Het
Ache A G 5: 137,291,914 I414V probably benign Het
Acy1 G A 9: 106,433,191 H308Y probably damaging Het
AF529169 T C 9: 89,601,652 H564R probably benign Het
Aldh1b1 A C 4: 45,803,661 I400L probably benign Het
Ankrd40 T A 11: 94,334,821 L226Q probably benign Het
B3gnt9 T C 8: 105,254,244 T171A probably benign Het
Ccdc33 T C 9: 58,069,851 Y289C probably damaging Het
Cd209f A T 8: 4,103,688 I187N probably damaging Het
Cers6 T G 2: 69,105,112 S319A probably damaging Het
Chrna4 A G 2: 181,028,872 S364P probably benign Het
Chrnb3 T C 8: 27,394,230 S317P probably damaging Het
Dapk1 T C 13: 60,760,960 V1129A probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Duox2 T C 2: 122,296,755 N147S probably benign Het
Dytn T G 1: 63,633,678 E522A probably benign Het
E130114P18Rik T C 4: 97,720,287 D27G unknown Het
Egf A G 3: 129,711,468 F118S probably damaging Het
Eif2d T A 1: 131,154,391 F73L probably damaging Het
Eps8l1 A G 7: 4,471,241 E237G possibly damaging Het
Espl1 A G 15: 102,305,730 E664G probably benign Het
Fbrsl1 A T 5: 110,379,029 S373T possibly damaging Het
Fras1 T A 5: 96,636,840 F894Y probably benign Het
Gm12800 T C 4: 101,909,170 V17A possibly damaging Het
Gpatch8 T C 11: 102,481,224 E496G unknown Het
Gucy1a2 A G 9: 3,759,588 K465E probably damaging Het
Igdcc4 A G 9: 65,124,015 T459A possibly damaging Het
Itgad A T 7: 128,204,625 I64F probably damaging Het
Itgb2l T A 16: 96,437,449 N50I probably damaging Het
Kif13a A G 13: 46,809,055 I478T probably damaging Het
Krt31 G A 11: 100,050,157 T109I probably benign Het
Ltbr G T 6: 125,307,474 probably null Het
Magel2 A G 7: 62,380,624 D1092G unknown Het
Mindy3 A T 2: 12,396,213 N231K probably damaging Het
Mpnd T G 17: 56,012,362 probably benign Het
Mtus2 C T 5: 148,077,416 L340F probably benign Het
Nanog G A 6: 122,707,906 A17T possibly damaging Het
Ndufa9 G T 6: 126,836,320 A181E probably damaging Het
Olfr619 T G 7: 103,604,374 L240R probably benign Het
Olfr869 A T 9: 20,137,562 I149F probably benign Het
Pprc1 ATCCTCCTCCTCCTCCTCCTC ATCCTCCTCCTCCTCCTC 19: 46,071,316 probably benign Het
Prkacb T C 3: 146,747,977 I211V possibly damaging Het
Ptpn14 C G 1: 189,851,277 L774V probably benign Het
Rad1 T C 15: 10,492,762 probably benign Het
Rims1 G T 1: 22,533,947 P391Q probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Sf3b3 C T 8: 110,816,329 R832Q probably benign Het
Slc12a2 A G 18: 57,934,963 D975G possibly damaging Het
Slitrk6 A G 14: 110,750,379 L632P probably damaging Het
Spire2 A G 8: 123,368,784 D542G possibly damaging Het
Sppl3 A T 5: 115,082,314 Q95L probably damaging Het
Stat5b C A 11: 100,784,254 E710* probably null Het
Tcl1 G T 12: 105,222,613 H14N probably damaging Het
Ten1 T C 11: 116,205,729 F70L probably benign Het
Tnfrsf13b A T 11: 61,140,937 T35S possibly damaging Het
Tpcn2 G A 7: 145,267,309 P336L probably benign Het
Trf C A 9: 103,228,048 D22Y probably damaging Het
Ttyh1 A G 7: 4,133,944 probably benign Het
Vmn2r103 A T 17: 19,811,769 I602F probably benign Het
Zfp296 G T 7: 19,579,712 C164F possibly damaging Het
Zfp352 A G 4: 90,224,304 Y227C probably damaging Het
Zfp599 A T 9: 22,258,123 W18R probably damaging Het
Other mutations in Dhx9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00500:Dhx9 APN 1 153465748 missense probably damaging 1.00
IGL01284:Dhx9 APN 1 153464898 missense probably damaging 1.00
IGL01555:Dhx9 APN 1 153459566 missense probably damaging 1.00
IGL01767:Dhx9 APN 1 153468868 splice site probably benign
IGL02938:Dhx9 APN 1 153464630 missense probably benign 0.37
R0001:Dhx9 UTSW 1 153462636 missense probably damaging 1.00
R0046:Dhx9 UTSW 1 153472707 missense probably benign 0.27
R0309:Dhx9 UTSW 1 153465695 missense probably benign 0.00
R0517:Dhx9 UTSW 1 153478916 missense possibly damaging 0.93
R0589:Dhx9 UTSW 1 153472291 missense probably damaging 1.00
R1217:Dhx9 UTSW 1 153458363 missense probably damaging 1.00
R1406:Dhx9 UTSW 1 153464938 missense probably damaging 1.00
R1406:Dhx9 UTSW 1 153464938 missense probably damaging 1.00
R1430:Dhx9 UTSW 1 153483747 missense probably benign 0.44
R1456:Dhx9 UTSW 1 153465695 missense probably benign 0.00
R1460:Dhx9 UTSW 1 153465680 missense probably benign 0.01
R1724:Dhx9 UTSW 1 153458488 missense probably benign 0.00
R1848:Dhx9 UTSW 1 153465753 missense probably damaging 0.99
R1922:Dhx9 UTSW 1 153460274 splice site probably null
R2001:Dhx9 UTSW 1 153456111 nonsense probably null
R3084:Dhx9 UTSW 1 153465699 missense probably benign 0.34
R3085:Dhx9 UTSW 1 153465699 missense probably benign 0.34
R3123:Dhx9 UTSW 1 153465706 missense possibly damaging 0.90
R3730:Dhx9 UTSW 1 153478120 missense probably benign 0.16
R4274:Dhx9 UTSW 1 153468926 missense probably damaging 1.00
R4353:Dhx9 UTSW 1 153471789 missense probably damaging 1.00
R4560:Dhx9 UTSW 1 153467157 missense probably damaging 1.00
R4583:Dhx9 UTSW 1 153460303 missense probably damaging 0.98
R4598:Dhx9 UTSW 1 153467051 frame shift probably null
R4603:Dhx9 UTSW 1 153467051 frame shift probably null
R4889:Dhx9 UTSW 1 153481149 missense probably damaging 1.00
R5411:Dhx9 UTSW 1 153481223 missense probably benign 0.27
R5569:Dhx9 UTSW 1 153467092 missense possibly damaging 0.83
R5635:Dhx9 UTSW 1 153483747 missense probably benign 0.44
R5659:Dhx9 UTSW 1 153471735 missense probably damaging 1.00
R6128:Dhx9 UTSW 1 153478089 missense probably damaging 1.00
R6215:Dhx9 UTSW 1 153472463 missense probably damaging 1.00
R6428:Dhx9 UTSW 1 153456578 unclassified probably benign
R6489:Dhx9 UTSW 1 153456643 unclassified probably benign
R6717:Dhx9 UTSW 1 153473464 intron probably null
R7098:Dhx9 UTSW 1 153465022 missense probably benign
R7209:Dhx9 UTSW 1 153464623 missense possibly damaging 0.90
R7226:Dhx9 UTSW 1 153465677 missense probably benign 0.00
R7440:Dhx9 UTSW 1 153481231 missense probably benign
R7685:Dhx9 UTSW 1 153458406 missense probably damaging 0.99
R7712:Dhx9 UTSW 1 153465001 missense probably benign 0.07
X0066:Dhx9 UTSW 1 153472529 missense probably benign 0.00
Z1177:Dhx9 UTSW 1 153456575 missense unknown
Predicted Primers PCR Primer
(F):5'- GGTTCAAAATGAGCCAATTTCCC -3'
(R):5'- CTCGTGCTTATAGTGGCCATTG -3'

Sequencing Primer
(F):5'- TGAGCCAATTTCCCAATGTTAAG -3'
(R):5'- GAGTGAGTTGTTGATGAAATTCTCAC -3'
Posted On2017-12-01